Curvie wing Grishin, new species

http://zoobank.org/ AA5E15EB-F2B5-4675-8311-B776FC204789 (Figs. 11 part, 12, 13a)

Definition and diagnosis. This is the northeastern new species of Curvie Grishin, 2019 (type species Symmachia emesia Hewitson, 1867), distributed in eastern Mexico. It is genetically differentiated from both Curvie yucatanensis (Godman & Salvin, 1886), stat. rest. (type locality in Mexico, Yucatán) and Curvie emesia (Hewitson, 1867) (type locality in Nicaragua) at the species level (Fig. 11 red vs. purple and blue); e.g., their Fst / Gmin /COI barcode difference are 0.37/0.022/2.6% (17 bp) from C. yucatanensis and 0.44/0.012/1.8% (12 bp) from C. emesia . This new species differs from its relatives by the following combination of characters: a comparatively shorter aedeagus; a shorter basal segment of the valva; more curved in ventral view valvae with their distal ends directed posteriad, usually not diverging; and a shorter, bump-like transtilla in lateral view. Due to the cryptic nature of this species and significant individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne312.12.3:A99 T, cne312.12.3:A156G, cne312.12.3: T177 A, cne312.12.3:G312A, cne312.12.3:A474G; and COI barcode: 88C, T235 C, 283 T, A472 A, C526 T. Barcode sequence of a paratype. Sample NVG-5245, GenBank PV 549980, 658 base pairs: AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGAATAGAATTAGGAACTTCTGGCTCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTACCATTAATATTAGGAGCTCCAGATATAGCATTCCCTCGAA TAAATAATATAAGATTTTGACTTCTTCCCCCCTCATTATTTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCTTCTAATATTGC TCATGGAGGATCATCAGTTGATTTAGCTATTTTTTCATTACATTTAGCTGGGATTTCTTCTATTTTAGGTGCTATTAATTTTATTACTACTATTATTAATATACGAGTAAATAATTTATCT TTTGATCAAATACCTTTATTTGTTTGATCAGTAGGTATTACTGCACTTTTACTTTTATTATCTTTACCCGTATTAGCAGGAGCAATTACTATATTACTAACTGATCGTAATTTAAATACAT CATTTTTTGACCCAGCAGGAGGAGGAGATCCCATTTTATACCAACACTTATTT

Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 12a, bears the following three printed rectangular labels, two white: [USA: TEXAS: Hidalgo Co. | 2 air mi SE of Relampago | Old Rio Rico Rd., ex larva | GPS: 26.0667°, -97.8837° | larva collected 13-Jun-2015 | on Caesalpinia mexicana, adult ecl. | 4-Jul-2015, Grishin N.V. leg.], [DNA sample ID: | NVG-24103D07 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Curvie wing | Grishin] .

Paratypes: 18♂♂ and 16♀♀ in total: 8♂♂ and 7♀♀ data as the holotype except as stated: 1♂ NVG-3479 30-May, 2♂♂ NVG-3759 and NVG-3762 27-Jun, and ex larvae, found and reared on leaves of Erythrostemon mexicanus (Gray 1861) Gagnon & Lewis 2016, eclosed on: 1♀ 11-Jun, 1♂ and 1♀ NVG-24103D08 (Fig. 12b) 12-Jun, 2♀♀ 27-Jun, 1♀ 29-Jun, 1♂ 2-Jul, 1♂ 6-Jul, 1♂ and 1♀ 8-Jul, 1♀ 11-Jul, and 1♂ 13-Jul; USA, Texas, Hidalgo Co., N. V. Grishin leg.: 1♀ Weslaco, 26-Nov-2004 and 1♀ NVG-5245 Los Ebanos, 26.24259, −98.56121, 25-Nov-2015; and Mexico: Tamaulipas: nr. El Abra, Paso del Abra, ex ova on E. mexicanus, Roy O. Kendall & C. A. Kendall leg. [TAMU] : 1♂ NVG-11913 15-Feb-1974, genitalia NVG190113 -23 and 1♀ NVG-11914 16-Feb-1974, genitalia NVG190113 -24; Clench & Miller leg. [CMNH]: 1♂ NVG-23112B11 0-3 mi NW Gomez Farias, 9-Jan-1966 and 1♂ NVG-23112B10 9 mi W Soto la Marina, 8-Jan-1966, genitalia NVG240817-05 (Fig. 13a); and Ciudad Victoria: 1♂ NVG- 23112B12, 16-Aug-1962, H. A. Freeman leg. [CMNH] and Rio San Marcos, John Kemner leg. [MGCL] : 1♂ NVG-24087D03, 1-Jan-1987 and 1♀ NVG-24087D05, 29-Nov-1986; Nuevo Leon: Cola de Caballo: Roy O. Kendall & C. A. Kendall leg., [TAMU] : 1♂ NVG-11911 25-Oct-1979, genitalia NVG190113 -21 and 1♀ NVG-11912 23-Oct-1979, genitalia NVG190113-22 and 1♀ NVG-24087C12 19-Jun-1986, I. L. Finkelstein leg. [MGCL]; 1♀ NVG-19044E12, AMNH _ IZC 00338007 Hacienda Vista Hermosa, Ville Santiago, 20-Jun-1940, Hoogstraal & Knight leg. [AMNH]; and 1♂ NVG-24087C11 Raices, 8-Jul-1986, John Kemner leg. [MGCL]; San Luis Potosí: Ciudad Valles: H. A. Freeman leg. [CMNH]: 1♂ NVG-23112B08 3-Aug-1956 and 1♀ NVG-23112B09 16-Jul-1970; 1♂ NVG-24087D06 Hwy 70, 22 km W of Ciudad Valles, 17-Oct-1984, H. D. Baggett leg. [MGCL]; and 1♀ NVG-24087D07 Hwy 85, ca. 15 mi S Ciudad Valles, 22-Jun-1986, I. L. Finkelstein leg. [MGCL]; and 1♂ NVG-19044E11, AMNH _ IZC 00338006 Veracruz, Jalapa, old [AMNH] .

Type locality. USA: Texas, Hidalgo Co., 2 air mi southeast of Relampago, Old Rio Rico Road, GPS 26.0667, −97.8837.

Etymology. The name is inspired by the English name “Curve-winged Metalmark” applied to this species in the U.S. and is treated as a noun in apposition.

Distribution. From South Texas, USA, through eastern Mexico to Veracruz.