Curvie westwing Grishin, new species
http://zoobank.org/ B18E8D86-2A4B-46E3-A2E0-05137076A417
(Figs. 11 part, 13b–c, 14)
Definition and diagnosis. This is the northwestern new species of Curvie Grishin, 2019 (type species Symmachia emesia Hewitson, 1867), distributed in western and southern Mexico. It is sister to the new species described above and is genetically differentiated from it at the species level (Fig. 11 cyan vs. red); e.g., their Fst / Gmin /COI barcode difference are 0.23/0.021/1.7% (11 bp). This new species differs from its relatives by the following combination of characters: a comparatively longer aedeagus; a longer basal segment of the valva; less curved in ventral view, straighter valvae with their distal ends directed posteriad or weakly diverging; and a longer (but still short) transtilla in lateral view. Males of the new species are typically browner (less yellow) beneath, with less distinct markings by the wing margins. Due to the cryptic nature of this species and significant individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne5357.2.5:G18A, cne5357.2.5:T84C, cne5357.2.5:T132C, cne12609.1.3:C102A, cne12609.1.3:T186C; and COI barcode: 88T, T235T, 283T, A472A, C526C.
Barcode sequence of the holotype. Sample NVG-24087C09, GenBank PV549981, 658 base pairs: AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGAATAGAATTAGGAACTTCTGGTTCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATGCCTATTATAATTGGAGGATTTGGAAATTGACTTGTACCATTAATATTAGGAGCTCCAGATATAGCATTTCCTCGAA TAAATAATATAAGATTTTGACTTCTTCCCCCCTCATTATTTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCTTCTAATATTGC TCATGGAGGATCATCAGTTGATTTAGCCATTTTTTCATTACATTTAGCCGGTATTTCTTCTATTTTAGGTGCTATTAATTTTATTACCACTATTATTAATATACGAGTAAATAATTTATCT TTTGATCAAATACCTTTATTTGTTTGATCAGTAGGTATTACCGCACTTTTACTTTTATTATCTTTACCTGTATTAGCAGGAGCAATTACTATATTATTAACTGATCGTAATTTAAATACAT CATTTTTTGACCCAGCAGGAGGAGGAGATCCCATTTTATATCAACACTTATTT
Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 14, bears the following four rectangular labels (1 st handwritten, others printed), three white: [ Rancho El Sabino | 30 m NE of Obregon | Sonora, MEXICO | RAB, 23 Dec 1985], [Bailowitz colln. | MGCL Acc. | 2002-1], [DNA sample ID: | NVG-24087C09 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Curvie westwing | Grishin]. The holotype was collected by Richard A. Bailowitz. Paratypes: 12♂♂ and 7♀♀ from Mexico: 1♂ NVG-24087C08 Sonora, data as the holotype; Sinaloa: 1♂ NVG-23111D09 48 mi NW of Culiacán, 23-Oct- 1961, genitalia NVG240817-01 (Fig. 13b) [CMNH]; 1♀ NVG-19067D10 Hwy 40, mile 286, 26-27-Dec- 1991, R. Wells [UCDC]; 1♂ NVG-19044F01, AMNH _ IZC 00338008 Mazatlan, old [AMNH]; and Venadio, old [USNM]: 1♂ NVG-18045F02, USNMENT 01466474 Wm. Schaus collection and 1♀ NVG-18045F05, USNMENT 01466477 donated by B. P. Clark; Jalisco: 1♂ NVG-24087C10 dirt Rd. 15.5 km S of Mismaloya, hotel on Rte. 200, 13-15-Nov-1995, B. O’Hara collection [MGCL]; 1♂ NVG-19011F11 Hwy 200 below Vallarta, Las Juntas Verano, 1000 m, 8-Aug-1989, J. Kemner leg. [TMMC]; and 1♀ NVG-19067D09 Hwy 79, 1–3 mi NE of El Grullo Jnct, 4600', 28-Dec-1972, R. Wells leg. [UCDC]; Colima: 1♂ NVG-23111D10 Comala, 2100 ft, 22-May-1967, R. G. Wind leg, genitalia NVG240817-02 (Fig. 13c) [CMNH] and 1♀ NVG-19044F02, AMNH _ IZC 00338009 Santiago Bay, 25-Nov-1939, F. H. Rindge collection [AMNH]; Morelos: 1♂ NVG-18045F01, USNMENT 01466473 no location details, Aug-1979, Phil Mays leg. [USNM] and 2♂♂ NVG-24087D01 and NVG-24087D02 Cuernavaca, Feb- 1998, J. Brenner coll. [MGCL]; Guerrero: 1♂ NVG-19044F03, AMNH _ IZC 00338010 1.5 mi W of Acapulco, 60 m, 4-Sep-1967, Miller & Pine leg. [AMNH]; 1♀ NVG-19067D07 Acapulco, 22-Mar-1988 [UCDC]; 1♀ NVG-19044F04, AMNH _ IZC 00338011 Papanoa, 1-Dec-1939, F. H. Rindge collection [AMNH]; and 1♂ NVG-18045E11, USNMENT 01466471 Sierra de Guerrero, Dec-1910, R. Muller [USNM]; and 1♀ NVG-19044F05, AMNH _ IZC 00338012 Oaxaca, Santa Cruz Bay, 3-Dec-1939, F. H. Rindge collection [AMNH] .
Type locality. Mexico: Sonora, 30 mi northeast of Ciudad Obregón, Rancho El Sabino.
Etymology. The name indicates a more western distribution of this sister to C. wing sp. n. and is treated as a noun in apposition.
Distribution. Western and southern Mexico, from Sonora to Oaxaca.