Emesis (Aphacitis) bugaba Grishin, new species
http://zoobank.org/ 1A2FE025-11D5-4167-A28C-39E8452FE405
(Figs. 19 part, 20)
Definition and diagnosis. Genomic analysis of a pair of specimens from Bugaba, Panama, places them in a nuclear genome clade sister to several species of the subgenus Aphacitis Hübner, [1819] (type species Papilio dyndima Cramer, [1780], a junior homonym, current name applied to this species is Papilio lucinda Cramer, [1775]), such as Emesis aurimna (Boisduval, 1870) (type locality in Colombia) and Emesis parvissima Kaye, 1921 (type locality in Trinidad) (Fig. 19a), and, therefore, this pair represents a new species. In the mitochondrial genome tree, this new species is closest to another Panamanian species, Emesis auripana Grishin, 2024 (Fig. 19b), likely due to mitochondrial introgression. This new species differs from its relatives by males without a prominent but small pale spot near the forewing apex above (present in E. aurimna); with a developed apical pale frosting on the dorsal forewing (absent in E. parvissima), scattered over a wider area and more weakly separated from the rest of the wing by a paler band than in E. auripana and Emesis aurichica Grishin, 2024 (type locality in Mexico: Chiapas), but less distinct than in Emesis pruinapicalis Grishin, 2024 (type locality in Panama: Darien); being redder (rather than yellower) on the ventral side with more diffuse at the margins postdiscal brown bands; and females with a well-developed subapical cream patch and an apical triangle (larger than in E. aurichica), a paler submarginal smudge in the forewing cell M 2 -M 3, and a stronger developed brown pattern on the beige ventral side. Due to the cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne 2443.2.1:A909G, cne 2443.2.1:C912T, cne3195.1.6:A465G, cne243.2.8:A111G, cne5807.10.4:G303A; and COI barcode: A302G, C376T, 508C, T610C, A625A.
Barcode sequence of the holotype. Sample NVG-18053H09, GenBank PV549985, 658 base pairs: AACATTATACTTTATTTTTGGAATTTGATCAGGAATAGTCGGCACATCTTTAAGTTTATTAATTCGAATAGAATTAGGAACCTCAGGCTCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAACTGATTAGTTCCATTAATATTAGGAGCACCTGATATAGCTTTTCCACGAA TAAATAATATAAGATTTTGACTTTTACCGCCATCATTAATTTTATTAATTTCAAGAAGAGTTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGC CCATGGAGGAGCTTCAGTTGATTTAGCTATTTTTTCCCTTCATTTAGCTGGTATTTCATCTATTTTAGGAGCAATTAATTTTATCACAACAATCATTAATATACGTATTAATAATATGTCA TTTGATCAAATACCATTATTTGTCTGATCTGTTGGAATTACAGCTCTTTTACTTTTATTATCTCTTCCAGTTTTAGCCGGAGCTATTACTATATTATTAACAGATCGTAATTTAAATACAT CTTTCTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATACCAACATTTATTT
Type material. Holotype: ♂ deposited in the Museum für Naturkunde, Berlin, Germany (MFNB), illustrated in Fig. 20a, bears the following five rectangular labels (3 rd handwritten and framed, others printed; 3 rd green, 5 th red, and others white): [Panama | Bugaba | e.c.H.Stichel], [3268], [ aurimna Bsd.], [DNA sample ID: | NVG-18053H09 | c/o Nick V. Grishin], and [HOLOTYPE ♂ | Emesis (Aphacitis) | bugaba Grishin]. The 2 nd label gives the specimen number in the Stichel collection. Paratype: 1♀ NVG-24031D06 the same data as the holotype but Stichel collection number 3271 (Fig. 20b).
Type locality. Panama: Chiriquí Province, Bugaba .
Etymology. The name is given for the type locality and is a noun in apposition.
Distribution. Currently known only from western Panama.