Entheus guyaneus Grishin, new species

http://zoobank.org/ 630FF944-AA31-4407-A16A-9193FCA95218 (Figs. 31–32 part, 35, 36a–d, 50 part, 51e–f)

Definition and diagnosis. As detailed above, specimens from the Guianas that we initially identified as Entheus priassus (Linnaeus, 1758) (type locality in Suriname) partition into three species: E. priassus, Entheus talaus (Linnaeus, 1763), stat. rest. (type locality in the Amazonian region), and a new one, genetically differentiated from the others (Figs. 31–32); e.g., its COI barcodes differ by 0.6% (4 bp, the difference is small likely due to introgression of the COI barcode haplotype, similar in several species: Figs. 31b, 32b) from E. priassus, and by 1.8% (12 bp, a difference large for Entheus) from E. talaus . This new species keys to “ Entheus priassus priassus ” (B.10.4(a)) in Evans (1952) but differs from its relatives by a combination of the following characters: the doublet of semi-hyaline spots in the forewing cells M 1 - M 2 and M 2 -M 3 is stronger offset distad from the triplet of the subapical spots and is much narrower in a female; the semi-hyaline spot in the cell M 3 -CuA 1 is connected to the discal orange band with a narrower link (i.e., the spot is constricted before the discal band) in males, and is narrower in females and closer to the submarginal doublet of spots than to the spot in the cell CuA 1 -CuA 2; in males: the forewing discal orange band is typically narrower than in E. priassus, rather straight at the margins, with more limited hyaline areas distad, the hindwing is entirely dark brown on both sides, the hindtibial brush and tuft are orange-yellow; in a female: the hindwing white area above is larger than in E. priassus, the forewing semi-hyaline spots are smaller than in E. talaus, the spot in the cell CuA 1 -CuA 2 is slightly offset distad from the discal cell spot, and there is no pale spot in the cell CuA 2 -1A+2A by the vein 1A+2A. Due to the cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly3824.1. 21:T174C, aly3824.1.21:G180C, aly1042.23.1:C57T, aly1042.23.1:T78C, aly164.77.2:G24A; and COI barcode: C124C, 367T, T565C, T619T, A625G, T643C.

Barcode sequence of the holotype. Sample NVG-14062D01, GenBank PV549993, 658 base pairs: AACTTTATATTTTATTTTCGGAATTTGAGCAGGAATAGTAGGAACTTCCTTAAGATTATTAATTCGAACTGAATTAGGAACTCCTGGATCATTAATTGGAGATGATCAAATTTATAATACT ATCGTTACTGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTGGTACCTTTAATATTAGGAGCTCCTGACATAGCTTTTCCTCGAA TAAATAATATAAGTTTTTGACTCTTACCCCCATCATTAACATTATTAATTTCTAGAAGAATTGTTGAAAATGGAGCTGGAACAGGATGAACTGTTTACCCCCCTTTATCTGCTAATATTGC CCATCAAGGATCTTCTGTAGATTTAGCCATTTTTTCCCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATTTATCA TTTGATCAAATACCTCTATTTGTTTGAGCAGTAGGTATTACTGCATTACTTTTATTATTATCTTTACCCGTATTAGCAGGCGCTATTACTATACTTTTAACAGATCGAAATTTAAATACAT CATTTTTTGATCCTGCAGGGGGAGGAGATCCTATTCTCTATCAACACTTATTT

Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Figs. 35a and 51e (genitalia Fig. 36a–d), bears the following six printed rectangular labels, five white: [GUYANA: Cuyuni R, | Kamaria Falls 100' | 30.XI.-5.XII.2000 | 6°24'N 58°546'W | Leg. S.Fratello et al], [DNA sample ID: | NVG-14062D01 | c/o Nick V. Grishin], [DNA sample ID: | NVG-23119D12 | c/o Nick V. Grishin], [genitalia: | NVG240817- 39 | c/o Nick V. Grishin], [{QR Code} | USNM ENT 00179768], and one red [HOLOTYPE ♂ | Entheus | guyaneus Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. Paratypes: 1♂ and 2♀♀ with the same data as the holotype except as indicated: 1♂ NVG-14062C05 USNM ENT 00179818, 1♀ NVG-14062D05 USNM ENT 00275189, and 1♀ NVG-23112G08 Kartabo, 10-Jul-1925, G. D. Morgan leg. [CMNH] .

Type locality. Guyana: Cuyuni-Mazaruni Region, Cuyuni River, Kamaria Falls, approx. GPS 6.40, −58.77.

Etymology. The name is formed from the name of the country with the type locality and is treated as a masculine noun in apposition.

Distribution. Currently known only from north-central Guyana (Cuyuni-Mazaruni Region).