Entheus hyponota Grishin, new species

http://zoobank.org/ 88821A37-2D04-4B28-9571-10216DE05D49 (Figs. 31 part, 34d–f, 41, 50 part, 51l)

Definition and diagnosis. Genomic analysis of the female specimen illustrated by Staudinger (1884 – 1888) as a “male” (a lapsus on the plate but not in the text) of “ Entheus talaus ” (Linnaeus, 1763) reveals that it is sister to Entheus aureanota Austin, O. Mielke & Steinhauser, 1997 (type locality in Brazil: Rondônia), but is genetically differentiated from it at the species level (Figs. 31, 50): e.g., their COI barcodes differ by 2.1% (14 bp), thus representing a new species. This new species keys to “ Entheus priassus telemus ” (B.10.4(b)) in Evans (1952) but differs from its relatives by a combination of the following characters in a female (male unknown): the hindwing white area reaching the inner margin where it is overscaled with brown, dorsally about half of the white area size in E. aureanota, occupying less than half of the wing and the brown part of the wing towards the outer margin is wider than the white area; the subapical semi-hyaline forewing band is broken with the two posterior spots (submarginal doublet) offset distad from the rest (all spots are aligned in E. pralina); the white spot by the forewing vein 1A+2A is slightly smaller than the spot posterior to the vein CuA 2. Due to the cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly1313.35.3:G72A, aly1313.35.3:T75G, aly5294.28.5:C45G, aly5294.28.5:T75G, aly5543.1.4:G12C, aly 2668.6.1:G252G (not C), aly 2668.6.1:C273C (not T), aly256.9.3:T732T (not A), aly128.15.1:A729A (not G), aly1863.15. 1:G207G (not A); and COI barcode: T115C, 124C, A181G, T508C, A517G, T596C, T601C.

Barcode sequence of the holotype. Sample NVG-22091B03, GenBank PV549997, 658 base pairs: AACTTTATATTTTATTTTCGGAATTTGAGCAGGAATAGTAGGAACTTCCTTAAGATTATTAATTCGAACTGAATTAGGAACTCCTGGATCATTAATTGGAGATGATCAAATTTACAATACT ATCGTTACTGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGGGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCTGACATAGCTTTTCCTCGAA TAAATAATATAAGTTTTTGACTCTTACCCCCATCATTAACATTATTAATTTCTAGAAGAATTGTTGAAAATGGAGCTGGAACAGGATGAACTGTTTACCCCCCTTTATCTGCTAATATTGC CCACCAAGGATCTTCTGTAGATTTAGCCATTTTTTCCCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATCACAACAATTATTAATATACGTATTAGAAATTTATCA TTTGATCAAATACCTCTATTTGTCTGAGCAGTGGGTATTACTGCATTACTTTTATTATTATCTTTACCTGTATTAGCAGGTGCTATTACTATACTTTTAACAGATCGAAATCTAAACACAT CATTTTTTGATCCTGCGGGAGGAGGAGATCCTATTCTTTATCAACATTTATTT

Type material. Holotype: ♀ deposited in the Museum für Naturkunde, Berlin, Germany (MFNB), illustrated in Figs. 41 and 51l (genitalia Fig. 34d–f), bears the following six rectangular labels (first two handwritten, others printed), five white: [Massauary | Hahn.], [abgebildet], [DNA sample ID: | NVG-22091B03 | c/o Nick V. Grishin], [DNA sample ID: | NVG-24029A08 | c/o Nick V. Grishin], [genitalia: | NVG241114-19 | c/o Nick V. Grishin], and one red [HOLOTYPE ♀ | Entheus | hyponota Grishin]. It was collected by Paul Hahnel and illustrated in Staudinger (1884–1888). The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection.

Type locality. Brazil: Amazonas, Massauari.

Etymology. The name is given to rhyme with its sister species E. aureanota, replacing aureo - with hypo - (in Greek, meaning under- or below, and - nota meaning mark or spot in Latin) for the underdeveloped white region on the dorsal hindwing compared to its sister. The name is treated as a noun in apposition.

Distribution. Currently known only from the holotype collected in the middle Amazonian region in Brazil.