Cecropterus (Thorybes) notochlorothrix Grishin, new species

http://zoobank.org/ F47CF66E-9C31-4CBB-8789-B5F42D7DEC04 (Figs. 53 part, 54, 55a–b)

Definition and diagnosis. In addition to Cecropterus (Thorybes) virescens (Mabille, 1877) (type locality given as “Cayenne” [French Guiana?]) and Cecropterus (Thorybes) chlorothrix (Röber, 1925), stat. rest. (type locality Peru: Pasco, Huancabamba), genomic analysis reveals a third clade in this group genetically differentiated from the others at the species level (Fig. 53). This clade is sister to C. virescens in the nuclear genome (autosomes) tree (Fig. 53a) but is sister to C. chlorothrix in the Z chromosome (Fig. 53b) and the mitochondrial genome trees (Fig. 53c). Its Fst / Gmin /COI barcode difference are 0.23/0.005/2.0% (13 bp) (from C. virescens) and 0.17/0.012/1.4% (9 bp) (from C. chlorothrix). Therefore, this clade represents a new species. This new species keys to “ Urbanus virescens ” (C.13.27) in Evans (1952) but differs from its relatives by the following combination of characters: a distally rounded harpe (Fig. 55a) (more pointed in C. chlorothrix) without the distal and central broad projections of C. virescens (Fig. 55e, f) and with a narrower dorsal projection similar to that in Cecropterus (Thorybes) viridissimus Grishin, 2023 (type locality in Ecuador), which in addition possesses dull distal and central projections; slightly thicker and shorter uncus arms (Fig. 55a vs. c) that are more strongly diverging (Fig. 55b vs. d); a straighter dorsal surface of the tegumen and a more angled anteriad (vs. rounder) central bend in the vinculum in lateral view (Fig. 55a vs. c); a narrower forewing and a more elongated towards the tornus hindwing; generally darker facies, narrower semi-hyaline white spots and bars on the forewing, especially the subapical spots, and typically stronger overscaled with brown (within the white marginal band) apex of the ventral hindwing. Due to the cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly11426.2.3:C135G, aly11426.2.3:G141A, aly11426.2.3:C153A, aly18826.19.9:G42A, aly18826.19.9:C75T; and COI barcode: T82C, A109G, A217G, T274C, 400A, 517C. Barcode sequence of the holotype. Sample NVG-14111A02, GenBank PV550006, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCATTAAGTTTACTTATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGATGATCAGATTTATAATACT ATTGTTACAGCCCATGCTTTCATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCTCTTATATTAGGGGCTCCTGATATAGCTTTTCCTCGTA TAAATAATATAAGATTTTGATTATTACCCCCCTCCTTAACTCTTTTAATTTCAAGAAGTATTGTTGAAAATGGTGCAGGTACTGGTTGAACTGTTTATCCCCCTTTATCTTCTAATATTGC CCATCAAGGAGCATCAGTAGATTTAGCAATTTTTTCATTACATCTTGCAGGAATTTCATCTATTCTTGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAATTTATCA TTTGATCAAATACCATTATTTATTTGAGCTGTCGGAATTACAGCTTTATTATTATTACTTTCACTACCTGTTTTAGCTGGAGCCATTACTATATTATTAACTGATCGAAACTTAAATACTT CATTTTTTGATCCTGCAGGTGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 54, bears the following three printed (text in italics handwritten) rectangular labels, two white: [BRAZIL: Sta Catarina | Joinville, 0–200m | 26 O 19'S 48 O 53'W | 28.X.1989 | leg. H. Miers], [DNA sample ID: | NVG-14111A02 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Cecropterus (Thorybes) | notochlorothrix Grishin] . Paratypes: 4♂♂ from Brazil: 1♂ NVG-14111A03 Minas Gerais, Viçosa, 650 m, approx. GPS −20.750, −42.867, 9.II.1990, H. Miers leg. [USNM] and São Paulo, São Paulo, D. L. Lindsley leg. [MGCL]: 1♂ NVG-24124A07 13-Aug- 1960, genitalia NVG250517-04 (Fig. 55a–b) and 2♂♂ 26-Feb-1961: NVG-24124A08 and NVG-24124A09.

Type locality. Brazil: Santa Catarina, Joinville, elevation 0–200m, approx. GPS −26.3167, −48.8833.

Etymology. In Greek, νότιος (notios) means southern. This modified prefix is added to the name of a relative of the new species, C. chlorothrix, which itself is a composite of two Greek words: χλωρός (chloros) for green and θρίξ (trix) for hair, literally meaning green-haired. The name is treated as a noun in apposition.

Distribution. Currently known from Southeast and South Brazil.