Telegonus (Rhabdoides) alector ecuadoricus Grishin, new subspecies

http://zoobank.org/ 2CAECE29-3F03-40DC-9A82-8D56D3940278 (Figs. 61 part, 62, 63a–b, 89 part)

Definition and diagnosis. Genomic analysis reveals that two specimens from Ecuador, while being closely related to Telegonus alector (C. Felder & R. Felder, 1867) (type locality Colombia: Bogota) are genetically differentiated from it and form a clade sister to T. alector from Panama, Colombia and Venezuela (Fig. 61), although this differentiation is small. Their COI barcodes differ by 1.1% (7 bp). This barcode difference is larger than expected from nuclear genomic divergence (Fig. 61) and, therefore, this new taxon is conservatively proposed as a subspecies. This new subspecies keys to “ Astraptes alector alector ” C.14.26(b) in Evans (1952) and is similar to it in having brilliant blue (not greenish) wing bases and body above, and a white central band on the forewing in males. It differs from the nominate subspecies by its males with a more weakly expressed white central band on the dorsal forewing, which is heavier overscaled with brown, and its portion in the discal cell is very much reduced; a more prominent white costal area on the ventral forewing that reaches nearly half of the wing from the base; and a more strongly developed dark ventral wing pattern, including forewing subapical band and hindwing bands. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly294.13.1:T424A, aly294.13.1:T501A, aly3507.2.7:C39T, aly3507.2.7:A113C, aly322.20.17:C99T; and COI barcode: A43T, C136C, G477A, A517A, T568C, T646C.

Barcode sequence of the holotype. Sample NVG-19071H10, GenBank PV550010, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGTACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACTCCTGGATCTTTAATTGGAGATGATCAAATTTACAATACT ATTGTAACAGCTCACGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATAATAGGAGCCCCTGATATAGCTTTCCCCCGAA TAAATAATATAAGATTTTGACTTTTACCCCCATCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGC CCATCAAGGAGCATCAGTTGACTTAGCAATTTTCTCTTTACATTTAGCTGGTATTTCTTCTATTCTTGGAGCTATTAATTTTATCACAACAATTATTAATATACGAATTAATAATCTATCT TTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATCACAGCATTATTATTATTACTTTCTTTACCAGTTTTAGCAGGAGCCATTACTATATTATTAACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCTGGAGGAGGAGATCCAATTTTATACCAACACTTATTT

Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 62 (genitalia Fig. 63a, b), bears the following six printed rectangular labels, five white: [ECUADOR: Esmeraldas: | Río Chuchuví, km. 12.5 Lita- | San Lorenzo rd. 800-900m | 0° 53.01' N 78° 30.90' W | III.2001 I.Aldas leg.], [DNA sample ID: | NVG-19071H10 | c/o Nick V. Grishin], [DNA sample ID: | NVG-23119E04 | c/o Nick V. Grishin], [genitalia: | NVG240817-43 | c/o Nick V. Grishin], [USNMENT | {QR Code} | 01588533], and one red [HOLOTYPE ♂ | Telegonus (Rhabdoides) | alector ecuadoricus | Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. Paratype: 1♂ NVG-14111C04 Ecuador, Imbabura, Rumiñahui, 37 km N of Pedro Vicente Maldonado, elevation 500 m, GPS 0.2788, −78.9983, Apr-2001, I. Aldas leg. [USNM] .

Type locality. Ecuador: Esmeraldas Province, Río Chuchuví, km 12.5 of Lita–San Lorenzo Road, elevation 800-900 m, GPS 0.8835, −78.5150.

Etymology. The name is given for the type locality and is treated as a masculine noun in apposition.

Distribution. Currently known only from northwestern Ecuador.