Telegonus (Rhabdoides) pacificus Grishin, new species
http://zoobank.org/ 758A90B9-D934-4077-9A73-B04287A124AD (Figs. 61 part, 63e–f, 66, 89 part)
Definition and diagnosis. Genomic analysis reveals that many specimens formerly identified as Telegonus hopfferi (Plötz, 1881) (type locality in Mexico, likely south-central or southern, lectotype sequenced as NVG-22068G07) are either Telegonus gilberti (H. Freeman, 1969) (type locality in Mexico, San Luis Potosí, holotype sequenced as NVG-15104B08) or closer related to T. gilberti than to T. hopfferi in the Z chromosome and the mitochondrial genome trees (Fig. 61b, c). Among them, two specimens from the western slopes on the Andes in Ecuador and Peru are in the Z chromosome clade that is sister to T. gilberti (Fig. 61b) and form a clade sister to the new species described in the previous section, being genetically differentiated from it at the species level with a COI barcode difference of 2.1% (14 bp). Therefore, they represent a new species. This species keys (incompletely) to “ Astraptes alector hopfferi ” C.14.26(a) in Evans (1952) but differs from it by having bluish rather than greenish overscaling at the wing bases and body above (similar to T. gilberti), the forewing beneath lacking traces of apical pale spots, pale overscaling along the costal margin being reduced, while the discal cell pale spot is well-developed, crossing the entire cell; the blue area along the costal margin of the dorsal forewing being the longest, and extending distad beyond blue areas in the discal cell, in males the forewing above being paler in the middle, giving an appearance of a pale area in the cell CuA 2 -1A+2A that is heavily overscaled with brown; and the ampulla being closer associated with the dorsal process of the harpe and partly overlapping it (Fig. 63e, f). Due to the cryptic nature of this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly84.90.4:A223G, aly84.90.4:A399G, aly386.7.3:A570T, aly386.7.3:A645G, aly798.22.16:A15G; and COI barcode: T82C, T145T, A166A, A280G, T355C, T424T.
Barcode sequence of the holotype. Sample NVG-14111C02, GenBank PV550013, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCATTAAGATTACTTATTCGAACTGAATTAGGAACCCCTGGATCTTTAATTGGTGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTTCCATTAATAATAGGAGCCCCTGATATAGCTTTCCCTCGTA TAAATAATATAAGATTTTGACTTTTACCCCCATCATTGACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCCCCTCTCTCATCCAATATTGC CCACCAAGGAGCATCAGTTGACTTAGCAATTTTTTCTTTACATTTAGCTGGTATTTCTTCTATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAGATTATCT TTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTATTATTATTACTTTCTTTACCAGTTTTAGCAGGAGCTATTACCATATTATTAACTGATCGAAATCTAAATACCT CATTTTTTGACCCAGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 66 (genitalia Fig. 63e, f), bears the following five printed rectangular labels, four white: [PERU: Piura: Rio | Pusmalca, 800m, | 05 o 23'S 79 o 37'W | & June 2000 | Robbins & Lamas Leg.], [DNA sample ID: | NVG-14111C02 | c/o Nick V. Grishin], [DNA sample ID: | NVG-23119E06 | c/o Nick V. Grishin], [genitalia: | NVG240817-45 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Telegonus (Rhabdoides) | pacificus Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. Paratype: 1♂ NVG-14111C01 Ecuador, Esmeraldas, km. 18.5 of San Mateo-Puerto Libre Rd., Zapallo hilltop, elevation 500 m, GPS 0.8853, −79.5450, 28-31-Aug-2002, J. P. W. Hall & M. A. Solis leg. [USNM] .
Type locality. Peru: Piura Region, Río Pusmalca, elevation 800 m, approx. GPS −5.383, −79.617.
Etymology. The name is given for localities of the type series near the Pacific coast and is treated as a masculine noun in apposition.
Distribution. Currently known from near the Pacific coast and the western slopes of the Andes in Ecuador and Peru.