Telegonus (Rhabdoides) subfuscus Grishin, new species

http://zoobank.org/ 11069080-89AE-4111-8603-86E70A3E775B (Figs. 61 part, 63m–o, 71, 89 part)

Definition and diagnosis. A male from Santa Catarina, Brazil (in MGCL collection) identified as “ T. bifascia ” is not even in the same species group with Telegonus bifascia (Herrich-Schäffer, 1869) (type locality in tropical America to USA, likely in Brazil, as evidenced by genomic sequencing, lectotype sequenced as NVG-15031C04) but instead is closer related to the phenotypically different Telegonus cyprus (Evans, 1952), stat. nov. (type locality in Bolivia) while being genetically differentiated from it at the species level (Fig. 61); e.g., their COI barcodes differ by 4.3% (28 bp). Therefore, this misidentified “ T. bifascia ” represents a new species. This new species keys (incompletely) to “ Astraptes creteus siges ” C.14.28(e) in Evans (1952) but differs from it (and the very similar T. bifascia) by the ventral forewing postdiscal band in males being in the middle between discal and apical bands, aquamarine-colored wing bases and body above (not blue or greenish-yellow), darker forewing apex beneath continuing as an outer-marginal darker band, and narrower ventral hindwing dark bands in males. It differs from its sister species T. cyprus by having a much darker appearance beneath, e.g., a reduced pale area by the forewing tornus and the lack of a pale cross-band; more prominent dark spots nearly connected into bands, and a narrower hindwing. The valva is narrower in the middle as a result of a more concave costa and more constricted valva at its transition to the harpe; the ampulla is smaller, nearly triangular in lateral view, and wider separated from the dorsal process of the harpe (by a U-shaped groove); this process is narrower and longer; the harpe is terminally extended and its dorsoposterior margin is with a broad and shallow hump in the middle (Fig. 63m, o). Due to the cryptic nature of this species (compared to T. bifascia), most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly537.19.6:C123T, aly275211.5.10:A624G, aly275211.5.10:G630T, aly 1019.10.2: A1041G, aly235.14.1:G1496A; and COI barcode: A28G, T70C, T187C, T382C, T589C, T652C.

Barcode sequence of the holotype. Sample NVG-22078G12, GenBank PV550017, 658 base pairs: AACTTTATACTTTATTTTTGGAATTTGGGCAGGATTAGTTGGAACCTCTTTAAGTTTACTTATTCGAACCGAATTAGGAACTCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTCGGAAATTGATTAGTCCCCTTAATAATAGGAGCCCCTGATATAGCTTTCCCACGTA TAAATAATATAAGATTTTGACTTTTACCCCCATCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGC TCATCAAGGAGCATCAGTCGACTTAGCAATTTTTTCTTTACACTTAGCTGGTATTTCTTCCATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCT TTTGATCAAATACCTTTATTTATTTGAGCTGTTGGAATTACAGCATTATTATTATTACTTTCATTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGACCGAAACTTAAATACTT CATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATACCAACACTTATTT

Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 71 (genitalia Fig. 63m –o), bears the following six printed (text in italics handwritten) rectangular labels, five white: [Brazil, S.Catarina | Joinville 200m. | March 13-14, 1984 | McInnis, Coll.], [Genit. Vial | SRS- 3219], [ Telemachus bifascia | (Herrich-Schäffer, 1869) | ♂ | Det. S. R. Steinhauser], [CV Covell colln. | MGCL Acc. | 2006-9], [DNA sample ID: | NVG-22078G12 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Telegonus (Rhabdoides) | subfuscus Grishin]. Paratype: 1♀ NVG-23063F09 Brazil, Espirito Santo, Santa Teresa, elevation 800 m, 13-15-Feb-1972, C. Callaghan leg., genitalia vial SRS-1801 [MGCL] .

Type locality. Brazil: Santa Catarina, Joinville, elevation 200 m.

Etymology. The name is given for the ventral side (sub -) being darker (fuscus) than in its relatives. The name is a masculine adjective.

Distribution. South Brazil.

Comment. We list data on all labels of the holotype, verbatim, including identification labels. One of such labels contains an unpublished name “ Telemachus .” Here, we use Art. 8.3. of the ICZN Code and disclaim the name “ Telemachus ” for nomenclatural purposes. Thus, we consider this name to be unpublished.