Telegonus (Rhabdoides) colotrix Grishin, new species

http://zoobank.org/ 2148CD01-73EB-4D19-A482-EE1668D2F814 (Figs. 61 part, 74p–t, 79, 81a–b, 89 part)

Definition and diagnosis. Sequencing of several specimens from western Colombia that are phenotypically similar to Telegonus chiriquensis Staudinger, 1875 (type locality in Panama: Chiriquí) and less so to Telegonus meretrix (Hewitson, 1876), stat. rest. (type locality in Ecuador) reveals that they are sister to Telegonus erana (Evans, 1952), stat. nov. (type locality in Ecuador: Balzapamba) and are not monophyletic with T. chiriquensis being genetically differentiated from it at the species level (Fig. 61); e.g., their COI barcodes differ by 3.2% (21 bp). Therefore, these specimens represent a new species. This new species keys to “ Astraptes chiriquensis chiriquensis ” C.14.30(a) in Evans (1952) but differs from it and other relatives by broader wings with brown fringes above, the greenish-blue area on the ventral forewing being restricted to the very base, the hindwing area is blue rather than green, ventral forewing dark bands are narrower (especially the subapical short band) and stronger separated from each other, the yellow marginal area on the ventral hindwing is more weakly and evenly overscaled with brown scales even towards the apex and reaches the inner margin near the tornus (the tornal area is brown in T. erana, which has green, not blue, wing bases above). The ampulla is knob-like, and only slightly smaller than the dorsal process of the harpe, which is also knob-shaped and directed posterodorsad rather than just dorsad; the costa is nearly straight (basad of the concavity formed by the rising ampulla) or slightly bisinuate; the harpe is shorter than in relatives and is more rounded terminally, not as pointed as in other species (Fig. 74p–t). Due to the cryptic nature of this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly 1395.2.12:A75T, aly2124. 2.1:C615T, aly173.39.3:A199T, aly173.39.3:A165G, aly320.15.2:A51T; and COI barcode: A34G, T49T, T206T, T386C, T407T, T508G.

Barcode sequence of the holotype. Sample NVG-23063G02, GenBank PV550025, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGGTTAATTGGAACCTCTTTAAGATTACTTATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTCCCATTAATAATAGGAGCCCCTGATATAGCTTTTCCTCGTA TGAATAATATAAGATTTTGACTTTTACCCCCATCATTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCCGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGC CCATCAAGGAGCATCAGTTGATCTAGCTATTTTCTCTTTACATTTAGCTGGTATTTCTTCTATTCTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCT TTTGATCAAATACCTTTATTTGTGTGAGCTGTAGGAATTACAGCATTATTATTATTACTTTCATTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 79 (genitalia Fig. 74p–t), bears the following eight printed (text in italics handwritten) rectangular labels (3 rd blue, the last red and others white): [COLOMBIA: Cauca; SUAREZ | AREA 1600 m. | 14 / X /197 4 | No.C H-145 Coll. | by S.R. y L.M. Steinhauser], [ ASTRAPTES CHIRIQUENSIS | CHIRIQUENSIS STDGR. | ♂ | Det: S.R.Steinhauser], [PARATYPE ♂ | Telemachus | draudti | S. R. Steinhauser], [SRS Database | No. 670], [Genit. Prep. | SRS- 921], [A. C. Allyn | Acc. 1975-17], [DNA sample ID: | NVG-23063G02 | c/o Nick V. Grishin], [HOLOTYPE ♂ | Telegonus (Rhabdoides) | colotrix Grishin]. Paratypes: 1♂ and 2♀♀: Colombia: 1♂ NVG-24028D04 no locality details, old, W. Kalbreyer leg. [MFNB]; 1♀ NVG-14104A03 (leg DNA extraction, sequenced), NVG-23119E11 (abdomen DNA extraction and dissection) Valle del Cauca, 5 km N of Darién, 1500 m, 16-Jan-1988, J. B. Sullivan leg., genitalia NVG240817-50 (Fig. 81a, b) [USNM]; and 1♀ NVG-18027G08, USNMENT 01465202 old, from the Neumögen collection [USNM] with a handwritten label [ Telegonus | chiriquensis | Stgr. | chiriqui]. It remains unclear whether “chiriqui” on the label refers to the collecting locality of this specimen or the type locality of T. chiriquensis, probably the latter .

Type locality. Colombia: Cauca Department, Suarez area, elevation 1600 m.

Etymology. The name is a fusion of Colo [mbia] + [mere] trix for this species from Colombia previously misidentified as T. meretrix . Furthermore, it is a rather colorful species. The name is treated as a masculine noun in apposition.

Distribution. Currently known from Colombia.

Comment. We list data on all labels of the holotype, verbatim, including identification labels. One of such labels contains an unpublished name “ Telemachus draudti ”, but according to our sequencing results, this specimen is not conspecific with the intended “ holotype ” of this name. To avoid further confusion, we use Art. 8.3. of the ICZN Code and disclaim the name “ Telemachus draudti ” for nomenclatural purposes. Thus, we consider this name to be unpublished.