Telegonus (Rhabdoides) alardinus Grishin, new species

http://zoobank.org/ 427C08A0-E75F-4662-B454-1609D10ECC97 (Figs. 61 part, 85o–x, 88, 89 part)

Definition and diagnosis. Genomic trees reveal that specimens from Southeast and South Brazil that we identified as Telegonus alardus alardus (Stoll, 1790) (type locality in Suriname) formed a distinct clade genetically differentiated from other T. alardus populations, including Telegonus alardus latia (Evans, 1952) (type locality in Costa Rica) (Fig. 61): e.g., Fst / Gmin of 0.22/0.014. While their COI barcodes differ from the T. alardus haplotype from the nominotypical populations by 0.9% (6 bp), genetic uniformity of T. alardus across both American continents and stronger genetic differentiation in the nuclear genome compared to that in the mitochondrial genome suggests species-level status of the Brazilian taxon. This new species keys to “ Astraptes alardus alardus ” C.14.25(c) in Evans (1952) but has the hue of brown ground color beneath more into yellow rather than red-to-purple in T. alardus; stronger and more contrasting with the ground color dark spotting on the ventral side basad of white margins; bluish-green areas on the dorsal side more restricted than in a typical T. alardus; and usually more extensive white overscaling at the ventral wing margins with a better defined inner border of white areas and white overscaling entering the apical area of the forewing. Due to the cryptic nature of this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly12063.11.2:A48T, aly4333.9.8:C120G, aly144.42.3:T153C, aly116.28.6:G22A, aly116.28.6:A168G; and COI barcode: C136C, T220C, T418C, T508A.

Barcode sequence of the holotype. Sample NVG-23063G09, GenBank PV550032, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAGTTGGAACTTCATTAAGATTACTTATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCACGCATTTATCATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTCCCATTAATAATAGGAGCCCCCGATATAGCTTTTCCTCGTA TAAATAATATAAGATTTTGACTTTTACCCCCATCATTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCCGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAACATTGC CCATCAAGGAGCATCAGTTGATTTAGCTATTTTTTCCCTACATTTAGCTGGTATCTCTTCTATTTTAGGTGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATAATTTATCT TTTGATCAAATACCTTTATTTGTATGAGCTGTAGGAATTACAGCATTATTATTATTACTTTCATTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTT CATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 88 (genitalia Fig. 85o–s), bears the following five printed (text in italics handwritten) rectangular labels, four white: [BRASIL: R. de JANEIRO | Petropolis, 1500 m. | 1.V. 197 1 | C. Callaghan], [Genit. Prep. | SRS- 831], [A. C. Allyn | Acc. 1974- 3], [DNA sample ID: | NVG-23063G09 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Telegonus (Rhabdoides) | alardinus Grishin]. Paratypes: 2♂♂ and 4♀♀ from Brazil: Rio de Janeiro: 1♂ NVG-24064B03 Magé municipality, Suruí district, km 14 of Rio–Teresópolis Highway (BR-116), 5-Jul- 1971, C. Callaghan leg., genitalia NVG241111-02 (Fig. 85v–x) [MGCL], 1♀ NVG-19075D01, USNMENT 01588571 Teresópolis, Barragem Parque Nacional da Serra dos Orgãos, elevation 1100 m, approx. GPS −22.45, −43.00, 16-Feb-1995, Astrid Caldas and students leg. [USNM], and 1♀ NVG-24019B02 (no other data) old [SMF] and Santa Catarina: 1♂ NVG-19075C11 (leg DNA extraction, sequenced), NVG-23119F05 (abdomen DNA extraction and dissection), USNMENT 01588569, Joinville, Vila Nova, elevation 200 m, approx. GPS −26.367, −48.933, 23-Mar-1991, Robert K. Robbins & Olaf H. H. Mielke leg., genitalia NVG240817-56 (Fig. 85t, u) [USNM] and 1♀ NVG-24064B04 São Bento do Sul, Feb-1984, Rank leg. [MGCL] and 1♀ NVG-24028C09 Paraguay, old, P. Gladhorn S. K. [MFNB] .

Type locality. Brazil: Rio de Janeiro, Petropolis, elevation 1500 m.

Etymology. The name is formed from its sister species T. alardus and made longer to indicate a more southern distribution of this species. The name is treated as a masculine noun in apposition.

Distribution. Southeast and South Brazil and Paraguay.

Comment. Genitalia of the holotype, vial SRS-831, prepared by S. R. Steinhauser, became nearly transparent, likely due to overexposure in KOH, and were stained for photography with Double Stain containing lignin pink, acid fuchsin, GAA, lactic acid, and phenol (Fig. 85o–s).