Dobrisimastix vlkii Tedersoo sp. nov.
Diagnosis.
Separation from other species of Dobrisimastix based on ITS 2 (positions 85–104 tgcctggttgtctaactata; one mismatch allowed) and LSU D 2 (positions 477–496 ttaattcttcgaccgcaagg; one mismatch allowed) as indicated in Fig. 22. Intraspecific variation up to 1.5 % in ITS 2. Interspecific distance at least 8.4 % in ITS 2.
Type.
Vouchered soil sample TUE 003459 (holotype); eDNA sequence EUK 1189296 = OZ 253796 (legitype); eDNA sample TUE 103459 (nucleotype); GSMc plot S 961, temperate deciduous forest in Dobříš, Czechia, 49.7776°N, 14.1815°E .
Description.
Other sequences: EUK 0332259 (GSMc plot S 947, boreal forest soil in Malyi Tigirek, Altai, Russian Federation, 51.1247°N, 83.0368°E); EUK 0332261 (GSMc plot S 149, temperate Pinus forest soil in Stanislaus, CA, USA, 37.8138, –119.8926); EUK 0332264 (GSMc plot IH. ME 29, temperate Fagus orientalis forest soil in Mestia, Georgia, 42.9764°N, 42.5429°E); EUK 0332267 (GSMc plot G 2629, temperate mixed forest soil in Nigula, Estonia, 58.0458°N, 24.7119°E); EUK 0534684 (GSMc plot S 431, Arctic tundra soil in Toolik Lake, AK, USA, 68.622, –149.5977); EUK 0584891 (FunAqua sediment sample W 0220 s, Triefenbach, Germany, 49.2812°N, 8.1135°E); and EUK 0584892 (FunAqua sediment sample W 0525 s, Novaki, Croatia, 45.6573°N, 15.6345°E).
Etymology.
Dobříš (Czech) and mastix (Greek) refer to the type locality and Neocallimastix, respectively, and Vlk (Czech) refers to Lukáš Vlk, who collected the type material.
Notes.
Found in soil samples (88.9 %) and sediments of lakes (11.1 %) in tundra to warm temperate forests in the Northern Hemisphere (n = 18 localities). GlobalFungi reveals 227 additional records in soil (91.6 %), roots (5.7 %), and sediments (1.3 %) in Europe, North America, and Asia, with occasional findings from tropical forests in Kenya and South America.