Cantoromastix holarctica Tedersoo sp. nov.
Diagnosis.
Separation from other species of Cantoromastix based on ITS 2 (positions 33–52 actcgtaaaccattagtttt; one mismatch allowed) and LSU D 2 (positions 679–698 ttactcggccatgttagtct; one mismatch allowed) as indicated in Fig. 20. Intraspecific variation up to 1.1 % in ITS 2. Interspecific distance> 20 % in ITS 2 and> 15 % in LSU.
Type.
Vouchered soil sample TUE 000915 (holotype); eDNA sequence EUK 1124338 = OZ 253795 (legitype); eDNA sample TUE 100915 (nucleotype); GSMc plot S 383, urban park soil in Tartu, Estonia, 58.3889°N, 26.7031°E .
Description.
Other sequences: EUK 0482535 (temperate fallow soil in Haava, Estonia, 58.4611°N, 26.7738°E); EUK 0330677 ( Populus tremula forest soil in Vasula, Estonia, 58.4699°N, 26.7266°E); and EUK 0330675 (GSMc plot G 5923, Malus domestica cropland soil in Kalnabeites, Latvia, 57.1333°N, 24.8567°E); EUK 0330674 (GSMc plot G 5920, temperate grassland soil in Viinamärdi, Estonia, 58.2497°N, 26.5394°E); EUK 0330670 (temperate grassland soil in Kihnu, Estonia, 58.1467°N, 23.9852°E); EUK 0330673 (GSMc plot G 5930, Zea mays cropland soil in Saulkalne, Latvia, 56.8442°N, 24.4072°E); and EUK 0330671 (coppiced fallow soil in Lombi, Estonia, 58.4551°N, 26.7451°E).
Etymology.
Cantor (Latin) refers to singers, which reflects the origin of the type material at the song festival grounds, and mastix refers to Neocallimastix; and holos and arcticos (Greek) refer to the entire northern (holarctic) distribution of the type species.
Notes.
Found in eight soil samples in Estonia and Latvia. GlobalFungi records (n = 263) suggest a broader distribution in temperate North American and East Asian soils and a preference for treeless habitats.