Bryolpidium mundanum Tedersoo sp. nov.
Diagnosis.
Separation from other species of Bryolpidium based on ITS 2 (positions 226–245 ctgaaaacaattcgagtgat; no mismatch allowed) and LSU (positions 465–494 gacggggctctcgctcgtga; no mismatch allowed) as indicated in Fig. 38. Intraspecific variation up to 4.4 % in ITS 2. Interspecific distance> 20 % in ITS 2.
Type.
Vouchered soil sample TUE 028510 (holotype); eDNA sequence EUK 1124873 = OZ 253805 (legitype); eDNA sample TUE 128510 (nucleotype); GSMc plot G 5911, wasteland soil in Tartu, Estonia, 58.3809°N, 26.6917°E .
Description.
Other sequences: EUK 0530197 (GSMc plot G 6091, subtropical desert soil in Al Zita, Saudi Arabia, 28.9243°N, 35.4438°E); EUK 0530198 (urban park soil in Mildura, VIC, Australia, – 34.1854°N, 142.1696°E); EUK 0649726 (urban soil in Põlva, Estonia, 58.0666°N, 27.0939°E); and GlobalFungi records d 4847020 b 222 e 5 b 7830540 d 220 e 20499 (subtropical woodland soil in El Tepeyac, San Luis Potosi, Mexico, 57.7165°N, 27.0549°E); 32232805 aef 1 d 4510876 e 11 cba 753 f 7 d (temperate shrubland soil in Elche, Spain, 38.30, – 0.72); and 156 ae 55 aafdd 258247 d 24 e 567 a 23 cdf 3 (temperate forest soil in Ait Tamlil, Morocco, 31.56, – 6.99).
Etymology.
> Bryum (Greek and Latin) refers to its common habitat amongst mosses, and mundanum (Latin) refers to cosmopolitan distribution.
Notes.
Found in soil in urban (3 out of 4 records) and natural environments in Europe, the Arab Peninsula, and Australia. The soil habitat is supported by three additional GlobalFungi records from natural habitats in Spain, Morocco, and Mexico.