Nematovomycetales Tedersoo & Esmaeilzadeh-Salestani ord. nov.
Type family.
Nematovomycetaceae Tedersoo & Esmaeilzadeh-Salestani .
Diagnosis.
Distinguishable from other fungi based on diagnostic nucleotide signatures in 5.8S (positions 127–146 in N. soinasteënsis and S. cerevisiae atccggyaggtatacctatt or gcctgcaggtatacctattt or acgtgcaagtatacctattt; one mismatch allowed) and in LSU D 3 (positions 905–919 in N. soinasteënsis and 748–762 in S. cerevisiae: acccgatcctagctc; two mismatches allowed). Forms a monophyletic, least inclusive clade in Nematovomycetes, covering sequences EUK 1137920, EUK 1124402, EUK 1124400, AB 971072, EUK 1106088, OQ 702947, GQ 330624, OQ 702883, JN 054659, JN 054675, OQ 702805, EUK 1100016, EUK 1107129, EUK 1102228, EUK 1204135, EUK 1124398, EUK 1124395, EUK 1124396, EUK 1200775, and EUK 1124397 (Fig. 1).
Notes.
Currently includes Nematovomycetaceae and another potentially family-level group represented by sequences EUK 1137920 (forest soil in Estonia), EUK 1202819 (grassland soil in Estonia), EUK 1113339 (lake water in Sweden), and EUK 1124400 (lake sediment in Estonia).