Borikenia Tedersoo gen. nov.

Type species.

Borikenia urbinae Tedersoo .

Diagnosis.

Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V 9 (positions 1684–1703 in S. cerevisiae tgcggtccacatgttggcaa; one mismatch allowed) and ITS 2 (positions 26–45 in type species ttggtggacttggtcgttca; two mismatches allowed). Forms a monophyletic, least inclusive clade in Borikeniaceae, covering sequences EUK 1189254, EUK 0530094, and EUK 0530090 (Figs 1, 51).

Notes.

Recognized based on eDNA sequences only. Comprises four potential species represented by sequences EUK 0530090 (forest soil in India), EUK 0530094 (forest soil in Colombia), and EUK 0530095 (forest soil in Costa Rica).