Chthonolpidiaceae Tedersoo fam. nov.
Type genus.
Chthonolpidium Tedersoo .
Diagnosis.
Distinguishable from other fungi based on diagnostic nucleotide signatures in 5.8S (positions 142–154 in type species and 143–155 in S. cerevisiae tgttcgacaycc; one mismatch allowed) and LSU D 2 (positions 695–714 in type species and 604–623 in S. cerevisiae gactgcttgcaggctgcata; one mismatch allowed). Forms a monophyletic, least inclusive clade in Chthonolpidiales, covering sequences EUK 1124876, EUK 0534797, EUK 0534798, EUK 0534818, EUK 1191212, and EUK 1138033 (Fig. 1).
Notes.
Recognized based on eDNA sequences only. Includes Chthonolpidium (gen. nov.) and potentially other genera represented by sequences EUK 1191212 (forest soil in Puerto Rico), EUK 0534797 (urban soil in China), EUK 0534798 (grassland soil in Norway), and EUK 0534818 (forest soil in Colombia).