Palomastix Tedersoo gen. nov.
Type species.
Palomastix lacustris Tedersoo .
Diagnosis.
Distinguishable from other fungi based on diagnostic nucleotide signatures in 5.8S (positions 116–135 in type species and S. cerevisiae gcctcccggtattccaggag; one mismatch allowed), SSU V 9 (positions 1691–1710 in S. cerevisiae tgttgggctcacgccctcct; one mismatch allowed), and ITS 2 (positions 129–148 in type species tctcaagttaagtgattggt; two mismatches allowed). Forms a monophyletic, least inclusive clade in Palomastigaceae, covering sequences EUK 1123686, EUK 0320705, and EUK 0320700 (Figs 1, 23).
Notes.
Recognized based on eDNA sequences only. Comprises four potential species represented by sequences EUK 0320699 (river sediment in Portugal), EUK 0320700 (lake sediment in Estonia), EUK 0320701 (lake sediment in Lithuania), EUK 0320702 (lake sediment in Spain), and EUK 0320705 (lake sediment in Norway).