Savannolpidiales Tedersoo & Esmaeilzadeh-Salestani ord. nov.
Type family.
Savannolpidiaceae Tedersoo & Esmaeilzadeh-Salestani .
Diagnosis.
Distinguishable from other fungi based on diagnostic nucleotide signatures in the ITS 2 - LSU interface (LSU positions – 2–18 in type species and S. cerevisiae aagtgatctgaaatcagaca; two mismatches allowed) and SSU V 8 (positions 1589–1608 in S. cerevisiae atgattcatcagatcatgct; two mismatches allowed). Forms a monophyletic, least inclusive clade in Savannolpidiomycetes, covering sequences EUK 1191209, EUK 1191210, EUK 0534704, EUK 1124874, EUK 1701673, EUK 1701672, and EUK 1124875 (Fig. 1).
Notes.
Recognized based on eDNA sequences only. Currently includes Savannolpidiaceae (fam. nov.).