Sedimentomastix tueriensis Tedersoo sp. nov.
Diagnosis.
Separation from other species of Sedimentomastix based on ITS 2 (positions 15–34 ctaaaagtcgggtttgattt; one mismatch allowed) and LSU D 2 (positions 572–591 gaaacaatggataaagggca; one mismatch allowed) as indicated in Fig. 26. Intraspecific variation up to 1.7 % in ITS 2. Interspecific distance> 15 % in ITS 2.
Type.
Wastewater sample TUE 032723 (holotype); eDNA sequence EUK 1152060 = OZ 253798 (legitype); eDNA sample TUE 132723 (nucleotype), Türi, Estonia, 58.8156°N, 25.4067°E .
Description.
Other sequences: EUK 0302143 ( Populus tremula forest soil in Soinaste, Estonia, 58.3408°N, 26.6864°E); EUK 0584897 (FunAqua stream water sample in Kangilleq, Greenland, 60.8571, –46.4233); EUK 0584898 (FunAqua river water sample W 0597 w in Aveleda, Portugal, 41.8919, –6.6972); and EUK 0584899 (FunAqua lake sediment sample W 0307 s in Goldwin, ND, USA, 47.0996, –99.0916).
Etymology.
Sedimentomastix refers to sedimentum (the Latin term for sediment) and Neocallimastix; the epithet refers to Türi (Estonian), the type locality.
Notes.
Found in water, sediment, and soil samples in Europe and North America (n = 5 records). GlobalFungi includes nine additional records, mainly from wetland soils in Europe, Asia, and North America.