Mycosocceriales Tedersoo, Bahram & Esmaeilzadeh-Salestani ord. nov.

Type family.

Mycosocceriaceae Tedersoo, Bahram & Esmaeilzadeh-Salestani .

Diagnosis.

Distinguishable from other species of Mortierellomycota based on diagnostic nucleotide signature in SSU V 9 (positions 1654–1663 in S. cerevisiae gattgaacgg; no mismatch allowed) and from all fungi in LSU D 2 (positions 573– 92 in the type species and 521–540 in S. cerevisiae aagttggaggaatgtggctc; two mismatches allowed). Forms a monophyletic, least inclusive clade in Mortierellomycetes, covering sequences EUK 0531595, EUK 1102426, EUK 1202279, EUK 0531631, EUK 1008618, and EUK 1124462 (Fig. 1).

Notes.

Recognized based on eDNA sequences only. Encoded as clade GS 61 in EUKARYOME v 1.9. Currently includes Mycosocceriaceae (fam. nov.). Comprises potentially 20–30 species. Detected in soil (93.2 % out of the 74 records) and sediments (6.8 %) in cold temperate to hot tropical biomes across all continents except Antarctica.