Parakickxella borikenica Tedersoo sp. nov.
Diagnosis.
Separation from other species of Parakickxella based on ITS 2 (positions 98–117 cgtgaacatatggtgccccc; one mismatch allowed) and LSU D 2 (positions 444–463 in the type species and 436–455 in S. cerevisiae cgccgcgctgtttgtgcgcg; one mismatch allowed) as indicated in Fig. 48. Intraspecific difference up to 1.4 % in ITS 2 and up to 0.5 % in LSU. Interspecific distance at least 15.0 % in ITS 2.
Type.
Vouchered soil sample TUE 000315 (holotype); eDNA sequence EUK 1189321 = OZ 253810 (legitype); eDNA sample TUE 100315 (nucleotype); GSMc plot S 045, tropical rainforest soil in El Yunque, Puerto Rico, 18.3167, –65.8167 °E .
Description.
Other sequences: EUK 1107422 (tropical rainforest soil in El Yunque, Puerto Rico, 18.29, – 65.78); EUK 0147219 (GSMc plot G 5034, tropical rainforest soil in Los Pinos, Puerto Rico, 18.1268, – 66.0724°E); and GlobalFungi accession dfbf 3 c 41964 a 835260 bb 3 a 9 afcdaf 69 a (tropical rainforest soil in Luquillo, Puerto Rico, 18.3, – 65.8).
Etymology.
Parakickxella (Latin) refers to a taxon distant from Kickxella, and Boriken (Taino) refers to the native name of Puerto Rico, where the type material and other specimens originate.
Notes.
Found exclusively in soil in Puerto Rico, which is confirmed by an additional GlobalFungi record.