Tartumyces setoi Tedersoo sp. nov.

Diagnosis.

Separation from other species of Tartumyces based on ITS 2 (positions 310–329 ggggggtataaaaactcgtt; one mismatch allowed) and LSU D 2 (positions 518–539 tattcgccggataatggtac; no mismatch allowed) as indicated in Fig. 62. Intraspecific variation up to 2.8 % in ITS 2. Interspecific distance at least 4.5 % in ITS 2.

Type.

Vouchered soil sample TUE 002210 (holotype); eDNA sequence EUK 1123648 = OZ 253817 (legitype); eDNA sample TUE 102210 (nucleotype); GSMc plot G 5233, wasteland in Tartu, Estonia, 58.3972°N, 26.7693°E .

Description.

Other sequences: EUK 1703744 (GSMc plot G 4372, mixed forest soil in Kiisli, Estonia, 58.6955°N, 26.9128°E); EUK 1703739 (GSMc plot G 3569, Quercus robur park soil in Äksi, Estonia, 58.5290°N, 26.6385°E); and EUK 1703737 (GSMc plot G 3413, Salix caprea forest soil in Väägvere, Estonia, 58.4389°N, 26.8976°E).

Etymology.

> Tartu (Estonian) refers to the city and county in Estonia, where the type material and most other specimens were collected. The epithet refers to Kensuke Seto, the first to obtain coarse single-cell photographs of species belonging to this phylum (Seto et al. 2023).

Notes.

Found in soil in Estonia (n = 4 records). An additional record in GlobalFungi also indicates occurrence in Estonian plantation soil.