Tibetochytrium taylorii Tedersoo sp. nov.

Diagnosis.

Separation from other species of Tibetochytrium based on ITS 2 (positions 85–104 ttggctatatctcgctttga; one mismatch allowed) and LSU (positions 656–675 ctgattgtcagtggagccat; no mismatch allowed) as indicated in Fig. 11. Intraspecific variation up to 3.8 % in ITS 2 and up to 1.0 % in LSU. Interspecific distance> 20 % in ITS 2.

Type.

Vouchered soil sample TUE 002260 (holotype); eDNA sequence EUK 1123755 = OZ 253790 (legitype); eDNA sample TUE 102260 (nucleotype); GSMc plot G 5283; Quercus robur plantation soil in Rahinge, Estonia, 58.3845°N, 26.5943°E) .

Description.

Other sequences: EUK 1186749 (GSMc plot S 949; boreal coniferous forest soil in Mt. Mayak, Altai, Russian Federation, 51.0443°N, 82.9694°E); EUK 1186750 (GSMc plot S 958, temperate broadleaf forest soil in Měšice, Czechia, 50.2006°N, 14.5284°E); EUK 1186752 (GSMc plot S 966; temperate broadleaf forest soil in Orlík nad Vltavou, Czechia, 49.5002°N, 14.1742°E); OW 841378 (unspecified soil in Tianshan Mountains, Uyghuria, China); MW 215915 (rhizosphere soil in Lithuania); EF 434111 (boreal forest soil in Bonanza Creek, AK, USA); EUK 0519405 (GSMc plot S 1406, grassland soil in Chuy, Kyrgyzstan, 42.5502°N, 74.5121°E); GU 311731 (grassland soil in KS, USA); OX 032019 ( Festuca brevipila roots in temperate grassland, Mallnow, Germany).

Etymology.

Tibet (Tibetan) refers to the region of the type habitat, and Taylor (English) refers to the last name of D. Lee Taylor, who was the first to collect material of this species (EF 434111; Taylor et al. 2007).

Notes.

The 18 records indicate occurrence mainly in soil (88.9 %), with single findings in roots and sediments. Distribution in temperate Eurasia, with two records from North America. The 140 additional GlobalFungi records confirm the soil habitat (97.9 %) but extend the distribution to temperate Australia, New Zealand, and Patagonia.