Nematovomycetes Tedersoo & Esmaeilzadeh-Salestani class. nov.
Type order.
Nematovomycetales Tedersoo & Esmaeilzadeh-Salestani .
Diagnosis.
Distinguishable from other fungi based on a diagnostic nucleotide signature in 5.8S (positions 127–146 in N. soinasteënsis and S. cerevisiae: atccggyaggtatacctatt or gcctgcaggtatacctattt or acgtgcaagtatacctattt or atccaaagagtatacttgtt; one mismatch allowed). Forms a monophyletic, least inclusive clade in Nematovomycota, covering sequences EUK 1217270, EUK 1137920, EUK 1124402, EUK 1124400, AB 971072, EUK 1106088, OQ 702947, GQ 330624, OQ 702883, JN 054659, JN 054675, OQ 702805, EUK 1100016, EUK 1107129, EUK 1102228, EUK 1204135, EUK 1124398, EUK 1124395, EUK 1124396, EUK 1200775, and EUK 1124397 (Fig. 1).
Notes.
Nematovomycetes currently harbors Nematovomycetales (ord. nov.) and a potentially order-level group represented by the sequence EUK 1217270 (lake sediment in Portugal).