Edaphochytrium valuojaense Tedersoo sp. nov.

Diagnosis.

Separation from other species of Edaphochytrium based on ITS 2 (positions 99–118 tttctataatatttttgaca; one mismatch allowed) and LSU (positions 614–633 tgagatatttctgatttttg; one mismatch allowed) as indicated in Fig. 9. Intraspecific variation up to 2.1 % in ITS 2 and up to 0.6 % in LSU. Interspecific distance at least 11.8 % in ITS 2 and 6.9 % in LSU.

Type.

Vouchered soil sample TUE 001432 (holotype); eDNA sequence EUK 1123748 = OZ 253789 (legitype); eDNA sample TUE 101432 (nucleotype); GSMc plot G 4257 z, Salix fragilis grove soil in Valuoja park, Viljandi, Estonia, 58.3643°N, 25.5859°E .

Description.

Other sequences: EUK 0133766 (GSMc plot G 3522, temperate deciduous forest soil in Pidula, Estonia, 58.4211°N, 22.1522°E); EUK 0474798 ( Populus × wettsteinii plantation soil in Nõgiaru, Estonia, 58.3262°N, 26.5545°E); and OU 941982 (grassland soil in Kungsängen, Sweden, 59.837°N, 17.661°E).

Etymology.

Edaphos (Greek) refers to ground, and Valuoja (Estonian) refers to the type locality.

Notes.

Found in soil across contrasting habitats in Estonia and Sweden (n = 4 records). GlobalFungi reveals an additional 35 records in European soils and two records in US soils, nearly all in cropland and grassland habitats.