Chthonolpidium enigmatum Tedersoo sp. nov.
Diagnosis.
Separation from other species of Chthonolpidium based on ITS 2 (positions 245–264 cacttggctgaaaaggttt; one mismatch allowed) and LSU (positions 608–627 ccttctagccctacggtacg; no mismatch allowed) as indicated in Fig. 40. Intraspecific variation up to 4.8 % in ITS 2. Interspecific distance at least 10.3 % in ITS 2.
Type.
Vouchered soil sample TUE 028510 (holotype); eDNA sequence EUK 1138033 = OZ 253806 (legitype); eDNA sample TUE 128510 (nucleotype); moss-dominated wasteland soil in Tartu, Estonia, 58.3808°N, 26.6917°E .
Description.
Other sequences: EUK 0534827 (type location); EUK 0534801 (temperate shrubland soil in Bliss, MI, USA); and EUK 0534800 (GSMc plot G 6167, subtropical shrubland soil in Al Hiwayb, Oman, 23.2140°N, 57.3337°E); and from GlobalFungi: 3949559 c 2 adbb 6 dd 485 ee 858 c 50 aa 75 b (shrubland soil in Morocco, 33.9766, – 3.3735°E); 170 f 6 c 5254 bf 08 a 8 d 3 be 2909670 b 3 d 85 (coniferous woodland soil in Utah, USA, 37.5819, – 109.91); 3 f 89 b 0 fffeb 9329 f 6 db 10351 b 45 fd 923 ( woodland rhizosphere soil in Spain, 37.888, –3.634); and 03 a 49631062976236 cecf 37723044 ad 8 (shrubland soil in Tunisia, 35.1678°N, 8.6738°E).
Etymology.
> Khthonios (Greek) refers to the common underground habitat, and enigma (Greek) means puzzling or mysterious.
Notes.
All four EUKARYOME and eight GlobalFungi records are derived from soil. Found in dry habitats in North Africa, Estonia, Spain, Oman, and the USA, indicating a cosmopolitan distribution.