Edaphochytriales Tedersoo ord. nov.

Type family.

Edaphochytriaceae Tedersoo .

Diagnosis.

Distinguishable from other fungi based on a diagnostic nucleotide signature in 5.8S (positions 45–64 catagtgaaatgtgataact in type species and S. cerevisiae; no mismatch allowed). Forms a monophyletic, least inclusive clade in Edaphochytriomycetes, covering sequences EUK 1671450, EUK 1671451, EUK 1008462, EUK 1200051, EUK 1101631, EUK 1101779, EUK 1123746, EUK 1200763, and EUK 1123748 (Fig. 1).

Notes.

Recognized based on eDNA sequences only. Currently includes Edaphochytriaceae (fam. nov.) and other potentially family-level groups represented by sequences EUK 1671450 (forest soil in Guadeloupe), EUK 1101631 (permafrost in Canada), EUK 1101779 (cropland soil in Great Britain), and EUK 1671451 (shrubland soil in Morocco).