Paraspizellomyces parrentiae Tedersoo sp. nov.
Diagnosis.
Separation from other species of Paraspizellomyces based on ITS 2 (positions 220–239 tttatgaattartgattgta; no mismatch allowed) and LSU (positions 562–581 ccgagtgttatagcctgagg; no mismatch allowed) as indicated in Fig. 5. Intraspecific variation up to 3.7 % in ITS 2. Interspecific distance at least 3.7 % in ITS 2; i. e., there is no clear barcode gap in ITS 2. In ITS 1, the maximum intraspecific difference 2.4 %, and the minimum interspecific distance 3.3 %.
Type.
Vouchered soil sample TUE 002024 (holotype); eDNA sequence EUK 1187441 = OZ 253787 (legitype); eDNA sample TUE 102024 (nucleotype) GSMc plot G 5047, tropical rainforest forest soil in Morne Louis, Guadeloupe, 16.1856, –61.7450 .
Description.
Other sequences: EF 619657 (soil in Pinus taeda plantation, NC, USA); EUK 0327288 (GSMc plot G 6004, tropical rainforest soil in Cascada Julieta in Panama, 9.2274, –79.4312); EUK 0327292 (GSMc plot G 4982, subtropical rainforest soil in Weiloi, Meghalaya, India, 25.3570°N, 91.6060°E); EUK 0327297 (GSMc plot S 372, subtropical forest soil in Menglun, Yunnan, China, 21.572°N, 101.57°E); EUK 0327298 (GSMc plot S 013, tropical woodland soil in Isalo, Madagascar, –22.5339, 45.3703); EUK 0327299 (GSMc plot S 765, tropical rainforest soil in Mbomole, Tanzania, –5.0946, 38.6292); and EUK 0519411 (GSMc plot S 1190, tropical rainforest soil in La Palma, Costa Rica, 10.5046, –84.6949).
Etymology.
Para (Greek) and Spizellomyces (Latin) refer to phylogenetic relatedness to Spizellomycetales, and Parrent (English) refers to Jeri Lynn Parrent, who was the first to collect material from this species (EF 619657; Parrent and Vilgalys 2007).
Notes.
Found in 18 soil samples in tropical and warm temperate forest habitats in North and South America, Africa, and Asia. The 33 additional GlobalFungi records confirm these findings but add that plant tissues may be an additional habitat (12.1 % of records).