Chthonolpidiales Tedersoo ord. nov.

Type family.

Chthonolpidiaceae Tedersoo .

Diagnosis.

Distinguishable from other fungi based on a diagnostic nucleotide signature in LSU D 2 (positions 695–714 in type species and 604–623 in S. cerevisiae gactgcttgcaggctgcata; two mismatches allowed). Forms a monophyletic, least inclusive clade in Chthonolpidiomycetes, covering sequences EUK 1124876, EUK 0534797, EUK 0534798, EUK 0534818, EUK 1191212, and EUK 1138033 (Fig. 1).

Notes.

Recognized based on eDNA sequences only. Currently includes Chthonolpidiaceae (fam. nov.).