Savannolpidiaceae Tedersoo & Esmaeilzadeh-Salestani fam. nov.

Type genus.

Savannolpidium Tedersoo & Esmaeilzadeh-Salestani .

Diagnosis.

Distinguishable from other fungi based on diagnostic nucleotide signatures in the ITS 2 - LSU interface (LSU positions – 2–18 in type species and S. cerevisiae aagtgatctgaaatcagaca; one mismatch allowed) and ITS 2 (positions 137–151 in type species gcgtactccttgtcc; two mismatches allowed) and SSU V 8 (positions 1589–1608 in S. cerevisiae atgattcatcagatcatgct; one mismatch allowed). Forms a monophyletic, least inclusive clade in Savannolpidiales, covering sequences EUK 1191209, EUK 1191210, EUK 0534704, EUK 1124874, EUK 1701673, EUK 1701672, and EUK 1124875 (Fig. 1).

Notes.

Recognized based on eDNA sequences only. Savannolpidiaceae includes Savannolpidium (gen. nov.) and other potential genera represented by sequences EUK 1701673 (forest soil in Madeira), EUK 1701672 ( woodland soil in Benin), EUK 0534781 (forest soil in Iraqi Kurdistan), EUK 1124875 (forest soil in Estonia), EUK 1191209 (forest soil in Puerto Rico), and EUK 0534704 (forest soil in Turkey).