Mirabilomyces abrukanus Tedersoo & R. H. Nilsson sp. nov.

Diagnosis.

Separation from other species of Mirabilomyces based on ITS 2 (positions 68–87 cttcggttwtaaaacaaggt; two mismatches allowed) and LSU (positions 534–553 ctacgctgtggttgcgcttt; one mismatch allowed) as indicated in Fig. 54. Intraspecific variation up to 11.4 % in ITS 2 due to length polymorphism in multiple mono- and dinucleotide repeats and up to 1.0 % in LSU. Interspecific distance> 20 % in ITS 2 and at least 6.0 % in LSU.

Type.

Vouchered soil sample TUE 000464 (holotype); eDNA sequence EUK 1200676 = OZ 253813 (legitype); eDNA sample TUE 100464 (nucleotype); GSMc plot S 208, Tilia cordata temperate forest soil in Abruka, Estonia, 58.1568°N, 22.5004°E .

Description.

Other sequences: EUK 0483305 (temperate broadleaf forest soil in Arcais, France, 46.3038, – 0.6844°E); EUK 1124377 (GSMc plot G 5235, Larix decidua plantation soil in Rõõmu, Estonia, 58.3835°N, 26.7742°E); EUK 1216948 (GSMc plot G 4777, flooded grassland soil in Suur-Pakri Härs-hämani, Estonia, 59.3310°N, 23.9272°E); EUK 1216949 (GSMc plot G 4679, Salix triandra wetland soil in Prangli Rivimaa, Estonia, 59.6150°N, 24.9871°E); OU 939561 (grassland soil in Kungsängen, Sweden, 59.837°N, 17.661°E); EUK 1202060 (GSMc plot G 4747, Prunus-Rhamnus-Euonymus forest soil in Tsirgumäe, Estonia, 57.5942°N, 26.3241°E); EUK 1216950 (GSMc plot G 4742, Fraxinus-Ulmus forest soil in Lüütre, Estonia, 58.1444°N, 25.2628°E); and EUK 1216946 (GSMc plot S 1366, temperate grassland soil in Innhavet, Norway, 67.9676°N, 15.9277°E).

Etymology.

Mirabilis (Latin) refers to the remarkable and astonishing finding of a large, unrecognized fungal lineage, and Abruka (Estonian) refers to the type locality of the species.

Notes.

Found in grassland and forest soils in North and Central Europe (n = 57 records), with single records from Asia, North America, and Africa. GlobalFungi reveals no additional information.