Palomastigaceae Tedersoo fam. nov.
Type genus.
Palomastix Tedersoo .
Diagnosis.
Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V 9 (positions 1664–1678 in S. cerevisiae tttagtgaggactcg; no mismatch allowed) and 5.8S (positions 116–135 in type species and S. cerevisiae gcctcccggtattccaggag or gcttcatggtattccgtga; one mismatch allowed). Forms a monophyletic, least inclusive clade in Palomastigales, covering sequences EUK 1124846, EUK 1123686, EUK 0320705, and EUK 0320700 (Fig. 1).
Notes.
Recognized based on eDNA sequences only. Harbors Palomastix (gen. nov.) and potential genus-level taxa represented by sequences EUK 0574070 (marine sediment in the Philippines), EUK 0137263 (forest soil in Mexico), and EUK 1124846 (wasteland soil in Estonia).