Mycosocceriaceae Tedersoo, Bahram & Esmaeilzadeh-Salestani fam. nov.
Type genus.
Mycosocceria Tedersoo, Bahram & Esmaeilzadeh-Salestani .
Diagnosis.
Distinguishable from other species of Mortierellomycetes based on diagnostic nucleotide signatures in SSU V 9 (positions 1654–1663 in S. cerevisiae gattgaacgg; no mismatch allowed), 5.8S (positions 90–99 in type species and S. cerevisiae tcatcaaatc; no mismatch allowed), and LSU D 2 (positions 573–592 in type species and 521–540 in S. cerevisiae aagttggaggaatgtggctc; two mismatches allowed). Forms a monophyletic, least inclusive clade in Mycosocceriales, covering sequences EUK 0531595, EUK 1102426, EUK 1202279, EUK 0531631, EUK 1008618, and EUK 1124462 (Fig. 1).
Notes.
Recognized based on eDNA sequences only. Currently includes Mycosocceria (gen. nov.) and other potentially genus-level groups represented by sequences EUK 1102426 (forest soil in Puerto Rico), EUK 0531595 (orchard soil in Estonia), and EUK 1202279 (forest soil in Italy).