Parnigua craigii Tedersoo sp. nov.
Diagnosis.
Separation from other species of Parnigua based on the ITS region (positions 51–80 actgagccttgcagcaacaatctccccttt; no mismatch allowed) and LSU (positions 444–463 ggcgggaaatcagcccccct; no mismatch allowed) as indicated in Fig. 13.
Type.
Soil eDNA sample TUE 102228 (holotype); type sequence: EUK 1635261 (lectotype); GSMc plot G 5251, Quercus robur woodland (soil sample TUE 002228) in Parnigu, Estonia, 58.64096 ° N, 26.38468 ° E .
Description.
Other sequences: EUK 1635874 (GSMc plot G 4499, calcareous Picea abies forest soil in Kurisoo, Estonia; 59.12808 ° N, 25.76395 ° E); EUK 1635875 (GSMc plot G 4746, Betula pendula forest soil in Karjamõisa, Estonia, 57.59761 ° N, 26.35493 ° E); EUK 1635878 (GSMc plot G 4794, Ulmus - Fraxinus forest soil in Lõhtsuu, Estonia, 57.91781 ° N, 26.52069 ° E); EUK 1603328 (GSMc plot G 4167, Salix pentandra peat soil in Tammispää, Estonia, 58.92051 ° N, 27.01118 ° E); EUK 1602985 (GSMc plot G 5923, Malus domestica orchard soil in Kalnabeites, Latvia, 57.1333 ° N, 24.8566 ° E); OU 939710 (grassland soil in Kungsängen, Sweden, 59.837 ° N, 17.661 ° E); and MH 625006 (grassland soil in Wakanui, New Zealand, - 43.668 ° N, 172.470 ° E), first isolated by Craig R. Anderson (Anderson et al. 2018).
Etymology.
Parnigu (Estonian) refers to type locality; and Craig (English) refers to the first name of Craig R. Anderson who was the first to record this species.
Notes.
Found from Estonia, Sweden and New Zealand, with ITS and LSU sequences differing up to 0.5 %. Found in all croplands, grasslands, deciduous and coniferous forests.