Unemaeea nathalieae Tedersoo sp. nov.

Diagnosis.

Separation from other species of Unemaeea based on the ITS region (5.8 S positions 122–151 gtcagtgtttgccacggagtatgccggctt; no mismatch allowed) and from other species of Endogonomycetes based on LSU (positions 694–723 gggcttgtcatggcagagggacacgtcgta; no mismatch allowed) as indicated in Fig. 17.

Type.

Soil eDNA sample TUE 100213 (holotype); eDNA sequence EUK 1630871 (lectotype); GSMc plot G 3318, marshland (soil sample TUE 000213) in Unemäe, Estonia, 58.28253 ° N, 22.46296 ° E .

Description.

Other sequences: EUK 1635887 – EUK 1635890 (type locality) and EUK 1213720 (FunAqua sample W 0581 s, river sediment in Floresti, Romania, 46.75472 ° N, 23.49923 ° E).

Etymology.

Unemäe (Estonian) refers to the type locality; and Nathalie (English) refers to the first name of Nathalie J. A. Curlevski who collected the first materials belonging to this genus.

Notes.

The end of 5.8 S and start of LSU are strongly diverged compared with other species of Unemaeea and Endogonomycetes . As no other confamilial LSU sequences are available, the diagnostic positions are compared against the most divergent, unalignable part across Endogonomycetes . Found in anoxic soil in Estonia and Romania, with ITS sequences displaying up to 4 % differences.