Ruua coralieae Tedersoo sp. nov.
Diagnosis.
Separation from other species of Ruua based on the ITS region (positions 217–243 gaaaaaaaaagaaaggaaagaaaaggt; one mismatch allowed) and LSU (positions 470–489 tagtgcacttgctttcgcac; no mismatch allowed) as indicated in Fig. 15.
Type.
eDNA sample TUE 101598 (holotype); eDNA sequence EUK 1603424; GSMc plot G 4464, Quercus robur forest (soil sample TUE 101598) in Ruu, Estonia, 59.45059 ° N, 25.22166 ° E .
Description.
Other sequences: EUK 1602853 and EUK 1600135 (type locality); EUK 1604050 (GSMc plot G 5002, Tilia - Quercus forest soil in Naissaar, Estonia, 59.57530 ° N, 24.53590 ° E); and EUK 1604051 (GSMc plot S 480, Populus - Picea forest soil in Käru, Estonia, 58.80407 ° N, 25.22249 ° E).
Etymology.
Ruu (Estonian) refers to type locality; and Coralie (French) refers to the first name of Coralie Damon, who collected the first materials belonging to this genus.
Notes.
Found from three sites in Estonia, with ITS and LSU sequences displaying up to 0.3 % differences.