Tammsaarea vivikae Tedersoo sp. nov.

Diagnosis.

Separation from other species of Tammsaarea and other species of Endogonomycetes based on ITS (positions 228–257 ggaccgagaaggcgcaatagttgaacaatt; one mismatch allowed) and LSU (positions 585–604 ataactatcggacaaagttt; one mismatch allowed) as indicated in Fig. 16.

Type.

eDNA sample TUE 100731 (holotype); eDNA sequence EUK 1602762 (lectotype); GSMc plot G 4189, Populus tremula forest (soil sample TUE 000731) in Tammsaare, Estonia, 57.84444 ° N, 27.20141 ° E .

Description.

Other sequences EUK 1604048 and EUK 1604049 (type locality).

Etymology.

Tammsaare (Estonian) refers to the type locality and one of the most famous Estonian writers, Anton Hansen Tammsaare; and Vivika (Estonian) refers to the first name of Vivika Adamson who provided access to the type locality.

Notes.

Found from a single locality in Estonia, with ITS and LSU sequences differing up to 0.5 % and 0.3 %, respectively.