Kungsaengena shadiae Tedersoo sp. nov.
Diagnosis.
separation from other species of Kungsaengena based on the ITS region (ITS 2 positions 25–44 tgggaacccatttcgtcgga; one mismatch allowed) and LSU (positions 665–694 cgttggggctgggacgcccgtcgctcgcac; one mismatch allowed) as indicated in Fig. 7.
Type.
eDNA sample TUE 128324 (holotype); eDNA sequence EUK 1603402 (lectotype); GSMc plot G 5763, wet grassland (soil sample TUE 028324) in Haage, Estonia, 58.35555 ° N, 26.61277 ° E) .
Description.
other sequences: EUK 1604022 (GSMc plot G 5906, football field soil in Karksi-Nuia, Estonia, 58.10088 ° N, 25.55959 ° E); EUK 1604023 (GSMc plot G 5844, wet pasture soil in Tuhala, Estonia, 59.23003 ° N, 25.00283 ° E); EUK 1604025 (GSMc plot G 4444, Estonia, mixed forest soil in Altnurga, Estonia, 58.53676 ° N, 26.28321 ° E); and OU 942286 (grassland soil in Kungsängen, Sweden, 59.837 ° N, 17.661 ° E), isolated by Shadi Eshghi Sahraei (Eshghi Sahraei et al. 2022).
Etymology.
Kungsängen (Swedish) refers to type locality; and Shadi (Persian) refers to the first name of Shadi Eshghi Sahraei who analysed materials collected from the type locality.
Notes.
Found from the Baltic States and Sweden, with ITS and LSU sequences differing up to 15 % and 1 %, respectively. The ITS region is infested with microsatellite-like regions and homopolymers, and many sequence variants have long deletions in multiple positions. K. shadiae seems to be generalist in terms of habitat type.