Sabellomma, NOGUEIRA ET AL., 2010

Capa, María & Murray, Anna, 2015, Integrative taxonomy of Parasabella and Sabellomma (Sabellidae: Annelida) from Australia: description of new species, indication of cryptic diversity, and translocation of some species out of their natural distribution range, Zoological Journal of the Linnean Society 175 (4), pp. 764-811 : 796-800

GENUS SABELLOMMA NOGUEIRA ET AL., 2010 , EMENDED

Sabelloma Nogueira et al., 2010: 4.

Type species: Parasabella minuta Treadwell, 1941 .

Diagnosis: Radiolar eyes irregularly distributed along outer margins, more numerous in areas with pigmented bands across radioles. Thoracic neuropodial companion chaetae with subdistal end enlarged, conspicuous microtubercles forming hood, resulting in dentate appearance, with thin distal mucro, generally flattened transversely.

Description: Sabellids ranging in length from 3–30 mm (including crown); thorax with 4–8 chaetigers and abdomen with numerous chaetigers. Radiolar crown with four to 22 pairs of radioles arranged in two semicircular radiolar lobes, may be involuted dorsally. Radioles without basal membrane, stylodes, or radiolar flanges; outer margins with numerous, irregularly distributed eyespots, usually more numerous in areas with pigmented bands across radioles. Radioles supported by four to six rows of vacuolated cells at bases. Dorsal lips with radiolar appendages; pinnular appendages absent or present, one to two pairs when present, may be fused partially to dorsal lip; distally rounded ventral lips, continuing ventrally as parallel lamellae; ventral sacs present or absent. Peristomial eyespots present subdermally. Posterior peristomial ring collar only just covering branchial lobes; dorsal margins well separated from faecal groove; one pair of triangular, nonoverlapping ventral lappets. Inter-ramal eyespots present, especially evident in abdomen, but may be faded or absent. Collar chaetae elongate, narrowly hooded, arranged in two oblique rows, ventral row chaetae shorter than dorsal; remaining thoracic notopodia with superior arc of elongate, narrowly hooded chaetae, inferior chaetae as two rows of broadly hooded chaetae of type A. Thoracic neuropodia with avicular uncini about as long as high, 4–5 irregular rows of teeth above main fang, extending less than half the length of main fang, well-developed breast, and medium handles (as long as distance from breast to main fang). Thoracic neuropodial companion chaetae with subdistal end enlarged, conspicuous microtubercles forming hood, resulting in dentate appearance, and with thin distal mucro at right angles to shaft and flattened transversely. Abdominal neurochaetae narrowly hooded in both anterior and posterior rows. Abdominal notopodia with avicular uncini similar to thoracic or with shorter handles. Pygidium triangular, distally blunt; eyespots present.

Remarks: The description of Sabellomma is here emended to incorporate the morphological differences observed in the new species and changes in the interpretation of the shape of the inferior thoracic chaetae. Sabellomma cupoculata sp. nov. lacks inter-ramal eyes, the dorsal margins of branchial lobes do not possess thickened ridges but instead radiolar lobes are involuted dorsally, peristomial eyes are present, companion chaetae with a very thin distal mucro are present, radioles are supported by six rows of vacuolated cells, and specimens with up to eight thoracic segments have been found; all different from previously described Sabellomma species ( Nogueira et al., 2010). Moreover, in the original description of the genus, the inferior thoracic chaetae of members of Sabellomma were considered as paleate, but as the shaft runs through the hood, the chaetae should be considered as broadly hooded ( Perkins, 1984; Fitzhugh, 1989; Capa et al., 2015). Sabellomma cupoculata sp. nov. lacks the ventral sacs described for the other three nominal species in the genus ( Nogueira et al., 2010).

The genus Sabellomma was erected to accommodate the type species previously considered as a Parasabella and subsequently as a Perkinsiana Knight-Jones, 1983 ( Treadwell, 1941; Knight-Jones, 1983), from Brazil, together with two new additional species from Hawaii and the Caribbean, all characterized by the presence of unpaired, simple eyespots along the outer margins of radioles and possibly also inter-ramal spots ( Nogueira et al., 2010). Both characters were considered as homoplastic because they have been reported in other sabellids ( Nogueira et al., 2010). This type and arrangement of radiolar eyes is also described in P. microphthalma ( Perkins, 1984) and in Pseudopotamilla cerasina ( Grube, 1870) . However, their presence in Parasabella microphthalma may be inaccurate and pigment spots mistakenly interpreted as eyespots (according to Nogueira et al., 2010), and Ps. cerasina , from the description (in which types were apparently not assigned) and from further notes on some other identified specimens, may actually be a Sabellomma and not Sabella , Potamilla , or Pseudopotamilla as previously suggested ( Grube, 1870; Knight-Jones, Knight-Jones & Ergen, 1991; Knight-Jones & Perkins, 1998). These two species may have the same type of companion chaetae and radiolar eyes as members of Sabellomma . Moreover, although Ps. cerasina apparently bears dorsal radiolar flanges, similar to those present in all members of Pseudopotamilla ( Knight-Jones & Perkins, 1998) , these could be in fact the basal, thickened ridges described in Sabellomma ( Nogueira et al., 2010: 4) . Conspicuous differences between Pseudopotamilla and Sabellomma , apart from the types of radiolar eyes, lie in the posterior peristomial ring collar dorsal margins, fused to the faecal groove in Pseudopotamilla and separated by a wide gap in Sabellomma ; and the type of interior thoracic chaetae, paleate (that is, with the shaft not reaching the tip of the hood) in Pseudopotamilla , and broadly hooded (with shaft along the hood), in Sabellomma . If this synonymy is verified then the presence of simple eyespots along the outer margins of radioles will be the synapomorphy for the genus.

SABELLOMMA CUPOCULATA SP. NOV. ( FIGS 4H , 5H, Y, Z, 18 , 19 )

Holotype: AM W.47193, Queensland, Lizard Island, High Rock , 14°49′34″S, 145°33′08″E, coll. from coral rubble, 20.1 m depth, L. Avery, 11.ix.2010, CReefs Stn LI 10- 134, MI QLD 2233 .

Paratypes: AM W.47192 (1), same as holotype ; AM W.47191 (4), Lizard Island , MacGillivray Reef (14°39′23″S, 145°29′31″E, coll. from coral rubble, 22 m, M. Capa & P. Hutchings, 29.viii.2010, CReefs Stn LI 10- 028, MI QLD 2197 .

Additional material examined (see Appendix for details): Australia. Western Australia: Lewis Island (two), Legendre Island (one) ; Northern Territory: Darwin Harbour (one); Queensland: Torres Strait (one); Lizard Island, (nine), Heron Island (one) .

Diagnosis: Unpaired, simple eyespots present, randomly arranged along radiolar lateral margins. Radioles supported by six rows of vacuolated cells near base. Thoracic ventral shields in contact with neuropodial tori. Inferior thoracic notochaetae of type A, with hoods 1.5 times as wide as shaft, and as long as four to five times maximum width. Thoracic uncini with short handles, and neck slightly shorter than breast.

Description: Holotype 7 mm long (excluding crown), 1 mm wide, radiolar crown 5 mm long. Thorax with seven chaetigers, abdomen with 47. Preserved holotype brown with white spots all over body ( Fig. 18K ). Radiolar crown with basal lobes as long as 1.5 thoracic segments, arranged in two semicircles ( Figs 18C–D, H–J , 19A–D ), slightly involuted dorsally. Radioles with rounded edges, flanges absent, with six rows of vacuolated cells supporting each radiole near base ( Fig. 4H ). Radiolar tips wide, tapering, bare for approximately length of pinnules. Cup-shaped radiolar eyes irregularly arranged along side margins of all radioles, except distally ( Fig. 18E–G ). Dorsal lips with radiolar appendages as long as three thoracic seg- ments ( Figs 18H–J , 19D ). One pinnular appendage fused to each dorsal lip, free for one-half to one-third of length, and joined to adjacent pinnule by membrane ( Fig. 18I, J ). Ventral lamellae present, ventral sacs absent ( Fig. 18H ). Posterior peristomial ring collar slightly increasing in length from dorsal to ventral side, covering junction of crown and peristomium, with low rounded ventral lappets, shorter than one thoracic segment ( Figs 18A–D, H, K, L , 19A–D ); dorsal margins with rounded edges ( Figs 18D , 19D ). Peristomial eyes present, subdermal. Inter-ramal eyes absent. Thoracic ventral shields four times wider than long, lateral margins in contact with neuropodial tori; first ventral shield m-shaped, twice as wide as long, with indentation along anterior margin. Collar chaetae elongate, narrowly hooded. Superior thoracic notochaetae elongate, broadly hooded ( Fig. 19E ); inferior thoracic notochaetae of remaining chaetigers with broadly hooded chaetae with progressively tapering distal tips (type A), with hoods 1.5 times width of shaft, and as long as 4–5 times maximum width ( Figs 5H, 19E, F ). Neuropodial tori similar in width along thorax, only slightly decreasing in width posteriorly. Uncini with 5–6 rows of teeth over main fang, covering just half length of main fang ( Fig. 19G ), well-developed breast, not reaching tip of main fang, neck longer than breast, handle short (shorter than the length of the distance between breast and main fang; Fig. 5Y). Thoracic neuropodial companion chaetae with subdistal end enlarged, conspicuous microtubercles forming hood, resulting in dentate appearance, and thin distal mucro flattened transversely, narrowing abruptly, tapering to long fine point ( Fig. 19H–J ). Abdominal neurochaetae narrowly hooded ( Fig. 19K ). Abdominal uncini with 5–6 rows of large teeth over main fang covering half length of main fang ( Fig. 19L, M ), uncinus proportionally higher than thoracic, with less defined breast and handle shorter than length of the distance between main fang and breast. Abdominal uncini decrease in size dorsoventrally within same torus. Pygidium a rim with ventral anus ( Fig. 19N ); red eyespots on both sides.

Variation: Specimens range in length from 3 ( AM W.20495) to 37 mm ( AM W.37060), including crown, with widths of 0.3–2.3 mm. Thoracic chaetigers vary from 5–8. Collar varies in height from length of one to two thoracic segments – larger specimens ( AM W.47189, AM W.37060) have higher collars with subquadrate dorsal margins, and 7–8 thoracic chaetigers, as well as more pronounced involution of dorsal radioles. Number of radioles varies from 5–22 pairs. Dorsal lips vary in length between 3–5 thoracic chaetigers. Ventral shields vary from 2–4 times wider than long, depending on contraction and type of fixation. Radiolar crown of live specimens with brownish base and some brown (∼five), white (∼seven), and purple (three to four) transverse bands irregularly arranged across radioles and pinnules ( Fig. 18A–D ). Colour patterns amongst specimens from Lizard ( Fig. 18A ) and Heron Islands ( Fig. 18B–D ) show some minor differences in number and width of colour bands in radiolar crown, but all specimens with brown radiolar base with white and bright purple transverse bands and small white spots over trunk. Some preserved specimens have little or no pigment remaining ( Fig. 18H ), whereas others remain brown ( Fig. 18K ). Pigment fades first from abdomen. Some specimens with little or no pigment in thorax after preservation may have small spots of pigment retained on ventral margin of the thoracic notopodial tori as well as ventral edges of neuropodial tori ( Fig. 18H ), unlikely to be eyes, and these appear to fade completely.

Reproductive features: None of the examined specimens were gravid females but some nontype specimens, greater than 8 mm in length, possessed sperm in anterior abdominal segments, forming creamywhite dorsolateral patches.

Genetic data: This species shows little genetic intraspecific variation (2.7 and 0.3%, comparing cox1 and ITS sequences, respectively). The specimens collected from Heron and Lizard Islands show the largest divergence, suggesting some population structure along the reported distribution range. The four specimens included in the analyses are characterized by several synapomorphies or barcodes, with some nucleotides scattered along the sequences and others, such as GCGCGTCCTGCGTTCCCTCCCCTCG in the 489– 513 nucleotide positions, configuring unique sequence blocks. The present phylogenetic hypothesis ( Fig. 3C ), after combination of the molecular and mitochondrial sequence data, suggests a sister-group relationship between Parasabella and Sabellomma , with maximum bootstrap support and genetic differences of over 25% in mitochondrial DNA fragments and over 40% in the nuclear fragment.

Remarks: Sabellomma cupoculata sp. nov. resembles the other congeners, all described from the Western Atlantic, in the presence of irregularly distributed lensed eyes on outer margins of radioles, and the presence of companion chaetae with a transversely flattened distal mucro. The main differences between S. cupoculata sp. nov. and previously described species are: the shape of these companion chaetae (the mucro narrows abruptly and looks almost needle-like under light microscopy in S. cupoculata sp. nov., whereas the other three species have broader distal ends); radioles are supported by six vacuolated cells in S. cupoculata sp. nov. and four in the other three species; and the radiolar lobes lack a thickened ridge on their dorsal edge, present in the other Sabellomma species , but are instead slightly involuted dorsally in S. cupoculata sp. nov. Moreover, none of the species previously reported have bright purple bands in the crown when alive, whereas these are very conspicuous in the new Australian species.

Sabellomma cupoculata sp. nov. resembles P. microphthalma in the type and arrangement of radiolar eyes in two irregular rows on outer sides of the radioles, if it can be verified that they are present in the latter species. However, these two species differ in the type of companion chaetae, which are representative of each of the two genera, and also in the

Figures

Figure 3. Maximum likelihood topologies. A, cytochrome oxidase 1 fragments. B, internal transcribed spacer fragment. C, combined data set. Bootstrap supports over 75% shown on nodes. Scale bar, average of nucleotide substitutions per site.

Figure 4. Cross-sections of radioles near the base showing the supporting cartilaginous vacuolated cells in the rachis (with grey nuclei), surrounded by an extracellular cartilaginous sheath (white) and covered by columnar epithelium (grey). Upper side of drawings are the outer margin of radioles; on the bottom incomplete pinnules are sketched with a blood vessel (black) in between. A, Parasabella aberrans spp. complex. B, Parasabella sp. cf. Parasabella aulaconota. C, Parasabella fullo. D, Parasabella bioculata sp. nov. E, Parasabella crassichaetae sp. nov. complex. F, Parasabella sp. cf. Parasabella japonica. G, Parasabella sp. cf. Parasabella rugosa. H, Sabellomma cupoculata sp. nov. A, AM W.36947; B, AMW.47009; C, ZMB 5731; D, AM W.46840; E, AM W.47181; F, AM W.36450; G, AM W.36431; H, AM W.47189.

Figure 18. Sabellomma cupoculata sp. nov., colour micrographs. A–D, live specimens. A, anterior end, ventral view. B, specimen missing posterior abdominal chaetigers, lateral view. C, radiolar crown and anterior thoracic chaetigers, lateral view. D, same, dorsal view. E–M, preserved specimens. E–G, detail of radiolar eyes along radiolar lateral margins. H, base of crown, ventral view, with crown opened showing ventral lips, dorsal lips with long radiolar appendages, and anterior thoracic chaetigers with ventral shields in contact with neuropodial tori and a dark pigment spot in between. I, J, half of radiolar crown showing dorsal lips with long radiolar appendages and pinnular appendages (arrow); dyed with methylene blue. K, thoracic chaetigers, holotype, lateral view, lacking inter-ramal eyes. L, thoracic chaetigers and collar. M, posterior thoracic and anterior abdominal chaetigers, lacking conspicuous inter-ramal eyes. A–D, AM W.37060; E–H, AM W.37060; I, J: AM W.37029; K, AM W.47193 (holotype); L, M, AM W.47189.

Figure 19. Sabellomma cupoculata sp. nov., scanning electron microscope photographs. A, whole specimen, ventral view. B, anterior thoracic chaetigers and base of radiolar crown, ventral view, showing collar with low ventral lappets. C, same, lateral view. D, same, dorsal view. E, midthoracic parapodium with elongate, narrowly hooded superior chaetae (arrow) and broadly hooded type A chaetae in inferior group. F, detail of inferior, broadly hooded chaetae of type B. G, thoracic uncini. H, I, companion chaetae, frontal view. J, companion chaetae, lateral view. K, midabdominal narrowly hooded neurochaetae. L, M, midabdominal uncini. N, posterior abdominal chaetigers and pygidium. A–N, AM W.39545.