Eurythenes andhakarae, D’Acoz, Cédric D’Udekem & Havermans, Charlotte, 2015

D’Acoz, Cédric D’Udekem & Havermans, Charlotte, 2015, Contribution to the systematics of the genus Eurythenes S. I. Smith in Scudder, 1882 (Crustacea: Amphipoda: Lysianassoidea: Eurytheneidae), Zootaxa 3971 (1), pp. 1-80 : 10-23

Eurythenes andhakarae sp. nov.

( Figs 1–11 )

Eurythenes gryllus clade Eg2.— Havermans et al., 2013: 14, fig. 5(13A)(14A)(15A), table 4.

Material examined. HOLOTYPE. RV Polarstern, expedition PS61, ANT-XIX/3, ANDEEP II, sta. 131-1, East of Antarctic Peninsula, 65°17'50"S 51°35'13"W to 65°17'53"S 51°35'17"W, 3069–3076 m, baited trap T6, 05– 08.iii.2002: 1 immature, sex unknown, 34 mm, dissected, absolute alcohol, RBINS, INV. 122772; Ant-a1, EG- 0 112105, JX887112 ( COI), JX887065 (16S), JX887078 (28S).

PARATYPES. Same station as holotype: 2 specimens, absolute alcohol, RBINS, INV. 122775; Ant-a2, EG- 0 112104, JX887116 ( COI), JX887077 (28S), JX887065 (16S).—RV Polarstern, expedition PS67, ANT-XXII/3, ANDEEP III, eastern Weddell Sea, sta. 59-1/59-15, baited trap, 67°30'00"S 00°00'06"E to 67°30'03"S 00°00'02"E, 4625 m, 14–16.ii.2005: 1 specimen, absolute alcohol, RBINS, INV. 122777; WDL-a2, EG-0112101, JX887138 ( COI), JX887075 (28S), JX887065 (16S).—Same station: 1 specimen, left pereopod 5 and pereopod 6 dissected and illustrated, absolute alcohol, RBINS, INV. 122776.—Same station: 7 specimens, absolute alcohol, RBINS, INV. 122774; one specimen (not isolated) has been sequenced: WDL-a1, EG- 21101012, JX887114 ( COI), JX887079 (28S), JX887065 (16S).—Same station: 95 specimens, absolute alcohol, RBINS, INV. 122770.—Same station: 10 specimens, absolute alcohol, ZMH K 44263 .—Same station: 10 specimens, absolute alcohol, CMNC 2014-0097.—ANT-XXII/3, northern Weddell Sea, sta. 110-1/110-9, 64°56'21"S 43°08'01"W to 64°56'26"S 43°08'07"W, 4693–4696 m, baited trap, 10.iii.2005: 18 specimens, absolute alcohol, RBINS, INV. 122771; 5 specimens were sequenced: WDL-b1, EG- 28071113: JX887116 ( COI), JX887081 (28S), JX887065 (16S); WDLb2, EG- 28071114: JX887119 ( COI), JX887066 (16S); WDL-b3, EG- 28071115: JX887116 ( COI), JX887081 (28S), JX887065 (16S); WDL-b4, EG- 28071116: JX887115 ( COI), JX887078 (28S), JX887065 (16S); WDL-b5, EG- 28071117: JX887065 (16S).—ANT-XXII/3, Weddell Sea / Scotia Sea, sta. 142-1/142-8, 62°12.40'S 49°31.67'W to 62°12.18'S 49°28.18'W, 3407–3411 m, baited trap, 18.iii.2005: 5 specimens, RBINS, INV. 122773; 4 specimens were sequenced: WDL-c1, EG-2807118, JX887117 ( COI), JX887065 (16S); WDL-c2, EG-2807119, JX887113 ( COI), JX887065 (16S); WDL-c3, EG- 28071110, JX887116 ( COI), JX887080 (28S), JX887065 (16S); WDL-c4, EG- 28071111, JX887118 ( COI), JX887078 (28S), JX887065 (16S).

NON-TYPE SPECIMENS. RV Polarstern, expedition PS67, ANT-XXII/3, ANDEEP III, eastern Weddell Sea, sta. 81-1/81-10, trap M14, 70°31.63'S 14°35.00'W to 70°33.72'S 14°30.00'W, 4412–4449 m, 23–24.ii.2005, initial fixation in formalin, coll. C. De Broyer and B. Danis: 15 medium-sized and adults (some specimens photographed), RBINS, INV. 122767.—Same station: about 60 small and medium-sized specimens, RBINS, INV. 122768.—Same station: about 100 small and medium-sized specimens, RBINS, INV. 122769.

Voucher DNA sequences. HOLOTYPE, Ant-a1, EG-0112105.

COI (GenBANK JX887112 ):

AACCTTGTACTTCGTTTTAGGTGCCTGAGCTAGAGTTGTTGGCACATCTCTTAGTGTTATTATTCGGTCT GAACTCAGTGGACCGGGAAACCTAATTGGAGATGATCAAATCTATAACGTAATAGTAACTGCCCACGC CTTTGTTATAATCTTCTTTATAGTTATACCTATTATAATTGGCGGATTTGGAAATTGGTTAGTCCCCCTAAT ACTTGGAAGCCCCGACATAGCTTTCCCGCGCATAAACAACATAAGATTTTGACTGCTGCCCCCCTCAC TGACCCTATTATTAATAAGAGGTCTGGTAGAAAGCGGTGTAGGAACCGGTTGAACAGTCTACCCACCC TTGGCCGCAGCCGCGGCCCACAGCGGGGGCTCTGTTGACCTGGCTATCTTCTCTCTTCACCTAGCAGG TGCTTCTTCCATCTTGGGCGCCATTAACTTCATCTCCACTGTAATTAACATGCGAACCCCTGGTATATAT A

28S (GenBANK JX887078 ):

GGCCTGCGGCGGAATGTTGCGTTAAGGGAAAGGTCGTAGTCAAACCCTACAACCACACGAACTCTAA GTCTGCCACGAATAGGCTATCCCAACTAACGGCGGGAGTGACTCCACGGAGGGTGTAAGACCCGTGT GGGCGTGTGTCAATGTTGTATGGGCTCGGCCTCTTCCCTGAGAGTCGCGTTGCTTGAGCATGCAGCGC TAAGCAGGTCGTAAACTCGATCTAAGGCTAAATATTTCCACAGGACCGATAGCAAACAAGTACCGTGA GGGAAAGTTGAAAAGCACTCTGAAGAGAGAGTCAAAAGACCGTGAAACCGCTCAGAGTATAAGCCC ATGGAGCTTGGAAGGCTTCCGCAGCGGCGTGCATCCCTTGTGGGTGTACGTGAGGACATTGTGAAAG GTTCGCTAGGCAGGGGGCAATCGAGTTTGTTACCCACCGCCGTGCTGGTGAATTGCCTGGGAGGAGT CGTGCCTCGGTGCGGCTCTCTTTTGGGTCGTTCTCATGTGTATGAACGTTCAAGGACAATGACCTAATG CGGTACGCCCACCACAGTTTGTTGTGAGGTCACCCACAGGCTCAAACTGTCGATCGTGTGTTCAGTG CGTGGCCTGAATTGTGTGCCGTTCGTAATATAGTGCCACCGTTATCTGTGTGGCGCTCCGGCATGCAGT CGCGCGCTGGACCAGGCGACGAAACGAGTATATCCTGGTATGATCCTCGTGCGACAATCTGATTCTGA CCGAGTGTACATCGCTACCGTTTGGCTCTGCCCATGTGTCGGGCGGAGTCAGGAGGTGCAACCTGATT GTCTGGTCCTCTGAACGATGTAACAGTCGATAAGATCTCAGTCGAGGTAGCGAACGACTCGCGTGGT GTTAAGTCCAGCACCATCGGTCACGTCTCGAAACACGGGCCAAGGAGTATAGCATGTGTGCAAGTCT AAGGGTCTCACAAAACCCGCAGGCGAAGTGAAAGCAAATGGTGTGGCGGGAGCGCTACGGCAATCT CGTCAGCCTTGTGGTGGTCAAAAACTACTCGGCTTAAACCGAGCTGATCCTGTTCTGTTGGCAATGTC TCAAGGCAGGCGCAAGCTCCGGGCTCACATACCAACACTGGCATCCTCACGGGTGCTGTGTTGTGAG CACCGTGGAGCATGCATGCTATAACCCGAAAGATAGTGAACTATGCCTGGCGAGGGCGAAGCCCCAG GAAACTGGGGTGGAGGCC

16S (GenBANK JX887065 ):

TGCTATAAGGGCAGTTTATGGTAAGGCCTGCCCAGTGATTAATTAAACGGCTGCGGTATATTGACCGTG CTAAGGTAGCATAATCATTTGTCTTTTAATTGGAGGCTGGAATGAAGGGTTTAACAAAGGATAGTGTCT TTATTTTAAATTTGTAATTTGTAATAAGAGTAAAAATACTCTGGTGCAATTAAGGGACGACAAGACCCT AAAAGCTTTATTTTTAATATAAGTTTGAGTTTAAAGCAGAACAGAGAGTTTAACTGGGGTAGTTTTTTT GTAAAATCTGAGGTTGTAAAAGACATGTAAAGTGGGGTTAGGTCCTTTAGATAAGGATAATTTGAGTG AGTTACTTTAGGGATAACAGCGTAATAGTCCTAGGGAGATCGTATCTATGGGGCTGATTGCGACCTCGA TGTTGAATTAAAAGCTCAGTGTAGAGCAGAAGCTACAGGGTGAGGGTTTGTTCAACCTTTAAATTTTT A

Type locality. East of Antarctic Peninsula, 65°17'50"S 51°35'13"W to 65°17'53"S 051°35'17"W, 3069–3076 m.

Etymology. Andhakāra, Sanskrit noun meaning darkness or complete darkness, Latinized as andhakara, - ae. The name, which is a genitive, alludes to the absolute darkness of the Antarctic abyss, where this species is thriving.

Description. If not specified, the description applies both to the 34 mm immature holotype and to the 95 mm adult male examined and dissected.

Body: pleosomite 3 with anterior concavity; other pleosomites and pereonites without anterior concavity.

Head: anterior lobe of head strongly produced; ventral corner of eye blunt and pointing obliquely backwards.

Mandible: article 2 of palp moderately expanded posteriorly and moderately tapering distally.

Maxilliped: inner plate with 3 nodular spines, which are not protruding.

Gnathopod 1: coxa straight anteriorly; basis broad, 2.3 (adult) to 3.0 (immature holotype) x as long as wide; palm normally developed, scarcely produced.

Gnathopod 2: coxa broad ventrally and weakly curved; propodus elongate, not expanded distally, 2.8 (immature holotype) to 3.4 (adult) x as long as wide, palm slightly curved and transverse, defined by 2 (immature holotype) to 5 (adult) spines.

Pereopod 3: coxa broad, 1.6 (adult) to 1.8 (immature holotype) x as deep as wide; basis stout, 2.8 x as long as wide; propodus stout, 4.5 (immature holotype) to 4.7 (adult) x as long as wide; dactylus stout.

Pereopod 4: coxa broad, 1.1 x as deep as wide (adult) to fairly broad, 1.2 x as deep as wide (immature holotype); junction between anterior and ventral border rounded but well distinct; ventral border slightly curved; posteroventral border straight and distinctly oblique (adult), straight and weakly oblique (immature holotype); leg almost identical with pereopod 3.

Pereopod 5: basis with posterior border slightly crenulated; merus narrow, 1.9 x as long as wide, with posterior border forming a regular curve; propodus of normal stoutness, 6.0 (immature holotype) to 6.3 (adult) x as long as wide, with 7 (immature holotype) to 12 (adult) groups of spines anteriorly; dactylus rather stout.

Pereopod 6: basis with posterior border distinctly crenulated (more strongly in immature holotype than in adult); merus narrow, 1.9 (adult) to 2.0 (immature holotype) x as long as wide, with posterior border forming a moderately convex and regular curve; propodus of normal stoutness, 6.5 (immature) to 6.9 (adult) x as long as wide, with 9 (immature holotype) to 13 (adult) groups of spines anteriorly; dactylus rather stout.

Pereopod 7: basis stout, with posterior border strongly expanded, with posterior border distinctly crenulated (much more strongly in immature holotype than in adult), with ornamentation of anterior border normal, 1.45 (immature holotype) to 1.5 (adult) x as long as wide, with posterodistal corner of lobe not produced and regularly rounded, ratio length of lobe of basis / total length of basis = 0.20 (adult) to 0.21 (immature holotype); merus narrow, 1.9 x as long as wide, with posterior border forming a regular curve; propodus of normal stoutness, 5.4 (immature) to 6.8 (adult) x as long as wide, with 9 (immature holotype) to 15 (adult) groups of spines anteriorly; dactylus rather stout.

Epimeron 3: ventrally well rounded, with small posteroventral tooth in specimens ≤ 35 mm.

Uropod 3: spines of distolateral angle of peduncle rather short and stout.

Colour pattern. Adults pure white or dull pink with coxae, appendages and some parts of the body tinged with bright red; eyes pale yellow.

Size. Up to 100 mm.

Distribution and depth range. Antarctica: Weddell Sea, 3070–4693 m.

Biology. The species is a scavenger, which enters baited traps in large numbers. Considerable size differences were observed between samples, suggesting a spatial segregation between size classes, which is in agreement with previous observations on the genus Eurythenes (e.g. Christiansen et al. 1990).

Remarks. In a genus like Eurythenes , which includes cryptic and very similar species, it is important to know at least one DNA sequence of the holotype. Adult specimens of E. andhakarae sp. nov. available for study were fixed in formaline, so they were unsuitable for DNA sequencing. Therefore a sequenced immature specimen was selected as holotype.

E. andhakarae sp. nov. is very similar to E. gryllus and E. magellanicus . The comparatively narrow merus of pereopods 6–7 and the regularly curved posterior border of the same articles separate E. andhakarae sp. nov. from these two related species. In E. gryllus and E. magellanicus , the merus of pereopods 6–7 is stout, with the distal half of its posterior border straight and steeply oblique, so that the merus is strongly tapering distally. The basis of pereopod 7 is also posteriorly more expanded in E. andhakarae sp. nov. compared with the two other species. The average number of groups of spines on the anterior border of the propodus of pereopod 5–7 seems to be higher in adult E. andhakarae sp. nov. than in other Eurythenes species, but this character is too variable to be used for identification purposes. E. andhakarae sp. nov. can also be separated from E. gryllus by the more produced anterior lobe of the head and by the ventral lobe of the eye which is rounded and directed obliquely backwards instead of being pointed and directed ventrally. The inner plate of maxilliped of E. andhakarae sp. nov. bears only three weakly protruding nodular spines, instead of at least 4 strongly protruding nodular spines in the case of E. magellanicus .

Figures

FIGURE 1. Eurythenes andhakarae n. sp., adults, non-type, about 100 mm. ANT-XXII / 3, sta. 81 - 1 / 81 - 10, East Weddell Sea, sta. 81 - 1 / 81 - 10, 70 ° 31.63 ' S 14 ° 35.00 ' W to 70 ° 33.72 ' S 14 ° 30.00 ' W, 4412 – 4449 m, RBINS, INV. 122767. A, white specimen (habitus); B, red specimen (habitus), C, red specimen (head). Photographs B. Danis, ULB, copyright RBINS.

FIGURE 2. Eurythenes andhakarae n. sp., adult male, non-type, 95 mm. ANT-XXII / 3, sta. 81 - 1 / 81 - 10, East Weddell Sea, sta. 81 - 1 / 81 - 10, 70 ° 31.63 ' S 14 ° 35.00 ' W to 70 ° 33.72 ' S 14 ° 30.00 ' W, 4412 – 4449 m, RBINS, INV. 122767. A, habitus; B, pleosome.

FIGURE 3. Eurythenes andhakarae n. sp., adult male, non-type, 95 mm. ANT-XXII / 3, sta. 81 - 1 / 81 - 10, East Weddell Sea, sta. 81 - 1 / 81 - 10, 70 ° 31.63 ' S 14 ° 35.00 ' W to 70 ° 33.72 ' S 14 ° 30.00 ' W, 4412 – 4449 m, RBINS, INV. 122767. A, palp of left Md; B, tip of inner plates of Mxp; C, left Gn 1; D, chela of left Gn 1; E, left Gn 2; F, propodus and dactylus of left Gn 2; G, chela of left Gn 2 (lateral view); H, chela of left Gn 2 (medial view).

FIGURE 4. Eurythenes andhakarae n. sp., adult male, non-type, 95 mm. ANT-XXII / 3, sta. 81 - 1 / 81 - 10, East Weddell Sea, sta. 81 - 1 / 81 - 10, 70 ° 31.63 ' S 14 ° 35.00 ' W to 70 ° 33.72 ' S 14 ° 30.00 ' W, 4412 – 4449 m, RBINS, INV. 122767. A, left P 3; B, propodus and dactylus of left P 3; C, left P 4.

FIGURE 5. Eurythenes andhakarae n. sp., adult male, non-type, 95 mm. ANT-XXII / 3, sta. 81 - 1 / 81 - 10, East Weddell Sea, sta. 81 - 1 / 81 - 10, 70 ° 31.63 ' S 14 ° 35.00 ' W to 70 ° 33.72 ' S 14 ° 30.00 ' W, 4412 – 4449 m, RBINS, INV. 122767. A, left P 5; B, left P 6; C, left P 7; D, tip of propodus of left P 7.

FIGURE 6. Eurythenes andhakarae n. sp., adult male, non-type, 95 mm. ANT-XXII / 3, sta. 81 - 1 / 81 - 10, East Weddell Sea, sta. 81 - 1 / 81 - 10, 70 ° 31.63 ' S 14 ° 35.00 ' W to 70 ° 33.72 ' S 14 ° 30.00 ' W, 4412 – 4449 m, RBINS, INV. 122767. A, right Ep 3; B, right U 1; C, right U 2; D, right U 3; E, ventral face of peduncle right U 3.

FIGURE 7. Eurythenes andhakarae n. sp., immature, holotype, sex unknown, 34 mm. ANT-XIX / 3, sta. 131 - 1, East of Antarctic Peninsula, 65 ° 17 ' 50 " S 51 ° 35 ' 13 " W to 65 ° 17 ' 53 " S 051 ° 35 ' 17 " W, 3069 – 3076 m, RBINS, INV. 122772. A, head and appendages; B, upper lip; C, lower lip (half of); D, left Md; E, right Md; F, left Mx 1 (palp not flattened); G, left Mx 2; H, Mxp; I, tip of left inner plates (setae and medio-facial spines not shown).

FIGURE 8. Eurythenes andhakarae n. sp., immature, holotype, sex unknown, 34 mm. ANT-XIX / 3, sta. 131 - 1, East of Antarctic Peninsula, 65 ° 17 ' 50 " S 51 ° 35 ' 13 " W to 65 ° 17 ' 53 " S 051 ° 35 ' 17 " W, 3069 – 3076 m, RBINS, INV. 122772. A, left Gn 1; B, chela of left Gn 1; C, left Gn 2; D, propodus and dactylus of left Gn 2; E, chela of left Gn 2 (facial view); F, chela of left Gn 2 (medial view).

FIGURE 9. Eurythenes andhakarae n. sp., immature, holotype, sex unknown, 34 mm. ANT-XIX / 3, sta. 131 - 1, East of Antarctic Peninsula, 65 ° 17 ' 50 " S 51 ° 35 ' 13 " W to 65 ° 17 ' 53 " S 051 ° 35 ' 17 " W, 3069 – 3076 m, RBINS, INV. 122772. A, left P 3; B, propodus and dactylus of left P 3; C, left P 4; D, telson.

FIGURE 10. Eurythenes andhakarae n. sp., ANT-XIX / 3, sta. 131 - 1, East of Antarctic Peninsula, 65 ° 17 ' 50 " S 51 ° 35 ' 13 " W to 65 ° 17 ' 53 " S 051 ° 35 ' 17 " W, 3069 – 3076 m. C, D, immature, holotype, sex unknown, 34 mm RBINS, INV. 122772; A, B, paratype, sex unknown, 34 mm, RBINS, INV. 122776. A, left P 5; B, left P 6; C, left P 7; D, propodus and dactylus of left P 7.

FIGURE 11. Eurythenes andhakarae n. sp., immature, holotype, sex unknown, 34 mm. ANT-XIX / 3, sta. 131 - 1, East of Antarctic Peninsula, 65 ° 17 ' 50 " S 51 ° 35 ' 13 " W to 65 ° 17 ' 53 " S 051 ° 35 ' 17 " W, 3069 – 3076 m, RBINS, INV. 122772. A, posterior half of body; B, left Ep 1; C, left Ep 2; D, left Ep 3; E, left U 1; F, left U 2; G, left U 3.