Gemmia buechei Brockmann and Grishin, 2022

Brockmann, Ernst, Zhang, Jing, Cong, Qian & Grishin, Nick V., 2022, Genomics reveals a new genus and species from a single female specimen (Lepidoptera: Hesperiidae: Hesperiinae: Hesperiini: Moncina), Insecta Mundi 2022 (957), pp. 1-8 : 2-4

Gemmia buechei Brockmann and Grishin , new genus and new species

https://zoobank.org/ 89315B0A-D839-453A-B9A7-81439D67C0F7 https://zoobank.org/ 66B847C1-C51D-450B-939B-0938D7AE7A5B

Diagnosis of the new genus. Differs from close relatives, such as Phlebodes and Dubia , by ventral hindwing pale spots in cells M 1 -M 2 and M 2 -M 3 being offset towards wing base, not aligned with other spots in postdiscal row; in female genitalia, ductus bursae with bursa copulatrix longer, reaching thorax, sterigma longer, and more expanded in its anterior portion, with rounder sides. Due to the lack of males and monotypic composition of the genus, it is best diagnosed by a combination of the following DNA characters: lac704.5.28:T96C, lac7147.4.1:C46A, lac884.3.3:A590T, lac221.9.2:A233A (not G), lac886.16.8:C464C (not A), lac49.46.10:G109G (not A), lac357.30.3:G1355G (not A), lac1895.5.35:T37T (not A), lac 1416.2.1:A449A (not G), lac580.72.1:T75T (not C), lac3441.2.1:A436A (not G), and lac886.16.8:T1215T (not C). See Appendix 1 for abbreviations and sequences.

Description of the new genus. We hypothesize that the following characters may be shared among species of the genus. Medium-sized, forewing length around 20 mm. Body brown, abdominal sternites with a median dark line, paler on either side of this line, especially in the distal half where they are overscaled with cream-colored scales. Antennae about half of forewing length, dark-brown, ventrally pale near the club, nudum brown. Wings brown, could be with pale spots, ventral side brighter colored, with rusty, orange, and yellow scales and white or pearly spots. In female genitalia ( Fig. 1c ), ductus bursae with bursa copulatrix very long, spanning the entire abdomen up to thorax, no signa, ductus gradually thickening towards bursa; ductus bursae ventrally sclerotized by sterigma, ductus seminalis connecting near sterigma, around the sclerotized area; sterigma expanded, nearly rectangular with concave sides in ventral view and on each side with a lateral ridge rounded caudad and protruding past lamella antevaginalis; lamella postvaginalis notched in the middle, on the sides connected through the expanded ridge to mostly convex, straight in the middle lamella antevaginalis.

Type species. Gemmia buechei Brockmann and Grishin , new species.

Species included in the genus. Only the type species.

Parent taxon for the genus. Subtribe Moncina A. Warren, 2008 .

Diagnosis of the new species. This mostly brown species is identified by nine or ten pearly spots on the ventral hindwing outlining an inverted heart pattern on a rusty-colored background.

Description of the new species. Female: (n=1, Fig. 1a,b ) right forewing length (wing base to apex) 19 mm in holotype. Palpi missing in the holotype. Fringes brown. Dorsally, wings dark chocolate brown, forewing with traces of pale subapical spots, costal area of hindwing paler. Ventrally, rust-brown to chestnut colored, with darker, nearly black-brown discal forewing area and paler, yellowish submarginal areas of wing and planer brown areas towards inner margins of both wings (except hindwing cell 3A rust-brown); forewing with 3 subapical pearly spots in a straight line and thickening from costa towards outer margin from a dash to nearly round, and a faint spot (patch of pearly scales) in the middle of cell M 3 -CuA 1; hindwing with ten large, mostly elongated pearly spots arranged to outline an inverted heart pattern: triplet of spots towards base, weakest (nearly missing on left hindwing) in cell CuA 2 -1A+2A, and heptad in postdiscal area arranged to form “3” on left wing, pattern alternatively described as two spot (one near base and one in outer half) in each of cells Sc+R 1 -RS and CuA 2 -1A+2A, and one spot in each of cells: discal (in distal, posterior area), RS-M 1, M 1 -M 2, M 2 -M 3, M 3 -CuA 1, and CuA 1 -CuA 2. For genitalia description ( Fig. 1c ) see description of the genus above, because we hypothesize that they would be mostly similar for all species in this genus. Male: unknown or unrecognized.

Barcode. The COI barcode sequence of the holotype (sample NVG-18066C02, GenBank accession ON256154 , 658 base pairs) is:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACATCCTTAAGTTTATTAATTCGTACAGAATTAGGAAATCCAGG TTCTTTAATTGGCGATGATCAAATTTATAATACTATCGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTAATACCTATTA TAATTGGGGGATTTGGTAATTGATTAGTTCCATTAATATTAGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAACATAAGATTT TGAATATTACCCCCATCCTTAATATTATTAATCTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGATGAACTGTATATCCCCC TCTTTCCTCTAATATTGCTCATCAAGGAGCATCTGTTGACTTAGCAATTTTTTCCTTACATTTAGCTGGAATTTCTTCTATTTTAG GAGCTATTAACTTTATTACTACAATTATCAATATACGAATTAGAAATTTAGCATTCGATCAAATACCTTTATTTGTCTGATCAGTAG GTATTACTGCATTATTATTACTTTTATCTTTACCTGTATTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACA TCATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Types. Holotype ♀ ( Fig. 1 ), presently in the research collection of Ernst Brockmann (Lich, Germany), to be deposited in the collection of the Museo de Historia Natural, Universidad Mayor de San Marcos, Lima, Peru, bears the following three rectangular labels: white printed and hand-printed [ Peru IV.2012 | Dept. San Martin | 1500-1800 m | ex coll. Michael Büche], white printed [DNA sample ID: | NVG-18066C02 | c/o Nick V. Grishin ], red printed [HOLOTYPE ♀ | Gemmia buechei | Brockmann & Grishin ].

Type locality. Peru: San Martin, elevation 1500–1800 m.

Etymology. The genus name Gemmia is a feminine noun in the nominative singular, given for the gem-like pearly spots on the ventral hindwing of the type species. The specific epithet buechei is named to honor its collector, Michael Büche, who generously gave many interesting specimens to the first author. The species epithet is a noun in the genitive case.

Figures

Figure 1. The holotype and phylogenetic placement of Gemmia buechei Brockmann and Grishin, gen. n., sp. n. a) Dorsal and b) Ventral views of the holotype, female, NVG-18066C02, from Peru: San Martin, additional data are in the text. c) Genitalia in ventral view, enlarged sterigma in ventral and right ventrolateral views: left, middle and right, respectively. d) Phylogenetic tree constructed from protein-coding regions of the Z chromosome: statistical support values (bootstrap fractions) are shown by the nodes, numbers after species names refer to DNA samples. Scale bars are shown by the images. For the tree, the unit is the estimated number of base pair substitutions per position (i.e., the scale bar corresponds to 2 substitutions per 100 positions). We sequenced a syntype of Megistias carinna Schaus, 1902, a name currently considered a junior subjective synonym of Lurida lurida (Herrich-Schäffer, 1869), thus the notation Lurida lurida (=carinna).