Aspidistra thuongiana Vislobokov, Nuraliev, V.C.Nguyen & V.T.Pham, 2021

Pham, Van The, Nguyen, Van Canh, Phan, Long Ke, Tran, Thanh Thi Viet, Nguyen, Van Khuong, Nuraliev, Maxim S. & Vislobokov, Nikolay A., 2021, Aspidistra thuongiana (Asparagaceae, Nolinoideae), a new species from the South Central Coast region of Vietnam, Phytotaxa 496 (3), pp. 261-268 : 264-266

Aspidistra thuongiana Vislobokov, Nuraliev, V.C.Nguyen & V.T.Pham , sp. nov. ( Fig. 1 , 2 )

Diagnosis: Aspidistra thuongiana is morphologically similar to A. longipedunculata , but differs in shorter peduncle and bowl-shaped (vs. campanulate) perigone with erect to spreading (vs. recurved) ovate (vs. oblong) lobes.

Type:— VIETNAM. Binh Dinh Province: Tay Son District, Tay Phu commune, evergreen lowland forests on silicate rocks, around point 13°50’16.5” N 108°51’27.9” E , at elevation 600 m a.s.l., 14 March 2020, Pham Van The, Nguyen Van Canh, Nguyen Van Khuong PVT1026 (holotype VNM!; isotype VNMN: VNMN-B0020346 !) .

Plant perennial, evergreen, herbaceous, rhizomatous, glabrous, ca. 40 cm tall. Rhizome creeping, epigeous, with short internodes, Ø 0.8 –1.2 cm. Roots grey, Ø 4–5 mm. Rhizomes with regularly repeating units, each unit comprising several distichous cataphylls followed by a single foliage leaf. Cataphylls oblong, 2.5–12 cm long, 1.2–1.3 cm wide, rapidly withering. Leaves petiolate. Petiole green, adaxially sulcate, 27–42 cm long, Ø 3–4 mm. Lamina green, lanceolate to elliptic, basally cuneate and apically acuminate, 21–28.8 cm long, 6.2–8.5 cm wide, with midvein prominent at abaxial surface. Inflorescences axillary, up to 6 or probably more per rhizome unit. Peduncle light green, sometimes with dark red specks, erect and slightly nutant, 4–6 cm long, Ø 1.5 –3 mm, with 4–5 distichously arranged bracts. Bracts pale green with dark red specks, broadly ovate, 4–8 mm long, 4–8 mm wide. Flower solitary at top of peduncle, odorless. Perigone widely bowl-shaped, uniformly bright yellow except for slightly paler central area of adaxial side, Ø 10–21 mm; tube bowl-shaped to almost disk-shaped, Ø 8–12 mm; lobes 5–8, erect to spreading, slightly overlapping each other, broadly ovate, 5–7.5 mm long, 3.5–9 mm wide. Stamens 5–8, inserted at base of perigone tube around base of pistil; anthers subsessile, broadly attached to perigone tube in form of a radial ridge, 3–4.5 mm long, 1–1.5 mm wide, latrorse-introrse. Pistil bright yellow, cylindrical to slightly conical, 5–7 mm long; ovary superior, Ø 1.5 –2 mm; style straight, cylindrical, slightly narrower than ovary; stigma circular, as wide as style, Ø 1 mm, with a depression of irregular shape at top. Fruit grayish green, subspherical, 17 mm long, Ø 14 mm, with fleshy pericarp, uniformly covered with short protuberances.

Notes:—In flowers of A. thuongiana with uneven number of tepals (i.e., five and seven), one of the tepals is significantly broader than the others. Moreover, there is a stamen in the radius of each “normal” tepal in these flowers, but the enlarged tepal usually has a pair of stamens in its sector. This is consistent with the idea of dicyclic perigone in Aspidistra (see also Vislobokov et al. 2014), and allows to characterize the flower of A. thuongiana as tri- to tetramerous with occasional union of two neighbouring tepal lobes.

Molecular description:—The 5S-NTS region of A. thuongiana is 692 base pairs long. Sequences of 5S-NTS belonging to 13 specimens of Aspidistra were found in GenBank. Of them, 5S-NTS region of A. thuongiana is most similar to that of A. paucitepala Vislobokov, Nuraliev & D.D.Sokoloff in Vislobokov et al. (2014: 272) (GenBank accession numbers KF465790 , KF465791 ), with the identity of 98.68% according to BLAST analysis. Aspidistra thuongiana differs from A. paucitepala in the following 38 nucleotide positions of 5S-NTS region (direct nucleotide positions): cytosine not thymine at position 121; guanine not adenine at position 122; presence of indel 30 bp long (GTTTATTGTTACCACTCCATCTCACAAATT) at positions 165–194; adenine not guanine at position 253; a 1 bp ( T) absence of indel between nucleotides 283 and 284; thymine not cytosine at position 325; adenine not guanine at position 502; adenine not thymine at position 524; cytosine not adenine at position 684.

Etymology:—The species honours Dr. Nguyen Thi Lien Thuong, a director of Institute of Applied Technology, Thu Dau Mot University, who contributes for Vietnam’s agriculture.

Distribution and ecology:— Aspidistra thuongiana is endemic to Tay Phu District, Binh Dinh Province, southern Vietnam. It grows together with bamboos, palms and ferns in shady area of evergreen forest with abundant exposed rocks. The dominant tree species in that area include representatives of the genera Litsea Lam. (Lauraceae) , Lithocarpus Blume (Fagaceae) , Barringtonia J.R.Forst. & G.Forst. (Lecythidaceae) and Vitex L. ( Lamiaceae ).

Phenology: —Flowering and fruiting in March–April in nature.

Conservation status: —We have observed a small population of Aspidistra thuongiana in its type locality with estimation of about 100 individuals. The forest inhabited by the new species is under a high level of disturbance and not included in any protected area. The species is at risk of threatening due to habitat loss by illegal selective tree logging and agricultural activities. Following IUCN (2019), the conservation status of the species is preliminarily estimated as DD (Data deficient). Future botanical surveys are needed for a complete conservation assessment of the species.

characters of the previously described species are taken from Chen & Fang (1982), Liang & Tamura (2000), Li (2004),

Huang (2007), Tillich et al. (2007), Tillich (2008, 2014), Tillich & Leong-Škorničková (2013).

Taxonomic relationships: —Within the genus Aspidistra , there is a group of morphologically similar species characterized by uniformly white or yellow perigone, quite long erect peduncle (4–23 cm long) and a slender pistil with stigma not wider or only insignificantly wider than the style ( Li 2004, Tillich 2008). This group comprises A. bella Averyanov, Tillich & K.S.Nguyen in Averyanov et al. (2018a: 205), A. campanulata Tillich in Tillich et al. (2007: 337), A. dolichanthera X.X.Chen in Chen & Fang (1982: 77) and A. longipedunculata D.Fang in Chen & Fang (1982: 78). Aspidistra thuongiana apparently belongs to this group, and the new species is probably most close morphologically to A. longipedunculata . These two species share uniformly bright yellow flowers with a variable number of tepals (5–8 in A. thuongiana and 6–10 in A. longipedunculata ) and stigma Ø ca. 1 mm. However, the new species differs from A. longipedunculata in shorter peduncle (4–6 cm vs. 10.5–22.5 cm), bowl-shaped (vs. campanulate) perigone, shorter (5–7.5 mm vs. 8–15 mm) ovate (vs. oblong) erect to spreading (vs. recurved) perigone lobes and stamens inserted at the base (vs. middle) of perigone tube.

Additionally, A. thuongiana is similar to A. jiewhoei Tillich & Leong-Škorničková (2013: 102) in bowl-shaped perigone with erect ovate lobes, but differs from the latter species in yellow (vs. purple) perigone coloration, stamens inserted at base (vs. upper part) of the perigone tube and stigma as wide as style, Ø 1 mm (vs. stigma wider than style, Ø 5–6 mm). The morphological differences between A. thuongiana and similar species are summarized in Table 1.

Figures

FIGURE 1. Aspidistra thuongiana, shoot structure. A. Habit. B. Inflorescence. C. Foliage leaf, adaxial view. D. Branching rhizome with inflorescences. E. Rhizome with inflorescences bearing flower buds, anthetic flower and a fruit. Pham Van The et al. PVT1026 (type). Photos by Van The Pham, correction and design by M. Nuraliev.

FIGURE 2. Aspidistra thuongiana, flowers and fruits. A–C. Flower with seven tepals and eight stamens, oblique view, front view and view from below. D. Flower with five tepals and six stamens, front view. E. Longitudinally dissected flower. F. Sector of perigone viewed from inside, showing abaxial side of stamens. G. Transversally artificially opened fruit. H. Fruit, side view. Pham Van The et al. PVT1026 (type). Photos by Van The Pham, correction and design by M. Nuraliev.