Polommatus (Agrodiaetus) australorossicus, Lukhtanov & Dantchenko, 2017

Lukhtanov, Vladimir A. & Dantchenko, Alexander V., 2017, A new butterfly species from south Russia revealed through chromosomal and molecular analysis of the Polyommatus (Agrodiaetus) damonides complex (Lepidoptera, Lycaenidae), Comparative Cytogenetics 11 (4), pp. 769-795 : 782-785

Polommatus (Agrodiaetus) australorossicus sp. n.

Holotype

(Fig. 9a, b ), male, BOLD process ID BPAL2013-13, field # CCDB-17947_B06, GenBank accession number MG243366; karyotype preparation DK-27-97, n=23; Russia, Caucasus, Daghestan, Gimrinsky Range, Gunib, 42.406274°N, 46.931548°E, 1680 m, 14 August 1997, A. Dantchenko leg., deposited in the Zoological Institute of the Russian Academy of Science (St. Petersburg).

COI barcode sequence of the holotype

(BOLD process ID BPAL2013-13; GenBank accession number MG243366).

ACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCCNTAAGAATTTTAATTCGTATAGAATTGAGAA CTCCTGGATCCTTAATTGGAGATGATCAAATTTATAACACTATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATA GTTATACCTATTATAATCGGAGGATTTGGTAACTGATTAGTTCCTTTAATATTAGGGGCACCTGATATAGCCTTTCCACG ACTAAATAATATAAGATTCTGATTATTACCGCCATCATTAATACTACTAATTTCCAGAAGAATTGTAGAAAATGGAGCAG GAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCACATAGAGGATCATCTGTAGATTTAGCAATTTTCTCT CTTCATTTAGCAGGAATTTCTTCAATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGGGTAAATAATTT ATCTTTTGATCAAATATCATTATTTATTTGAGCAGTGGGAATTACAGCATTATTATTACTTTTATCTTTACCTGTATTAG CTGGAGCAATTACCATATTATTAACTGATCGAAATCTTAACACCTCATTCTTTGATCCAGCTGGTGGAGGAGATCCAATT TTATATCAACATTTA

Paratypes.

9 males. (1) BOLD process ID BPAL2011-13, field # CCDB-17947_B04; karyotype preparation DK-34-1-97; Russia, Caucasus, Daghestan, Gimrinsky Range, Gunib, 1800 m, 15 August 1997, A. Dantchenko leg. (2) BOLD process ID BPAL2012-13, field # CCDB-17947_B05; karyotype preparation DK-34-2-97, n=ca23; Russia, Caucasus, Daghestan, Gimrinsky Range, Gunib, 1800 m, 15 August 1997, A. Dantchenko leg. (3) BOLD process ID BPAL2014-13, field # CCDB-17947_B07; karyotype preparation DK-7-97, n=ca22; Russia, Caucasus, Daghestan, Gimrinsky Range, Gunib, 1800 m, 12 August 1997, A. Dantchenko leg. (4) karyotype preparation DK-23-97, n=23, 2n=46; Russia, Caucasus, Daghestan, Gimrinsky Range, Gunib, 1800 m, 15 August 1997, A. Dantchenko leg. (5) karyotype preparation DK-30-97, n=23; Russia, Caucasus, Daghestan, Gimrinsky Range, Gunib, 1800 m, 15 August 1997, A. Dantchenko leg. (6) karyotype preparation DK-23-97-3, n=23; Russia, Caucasus, Daghestan, Gimrinsky Range, Gunib, 1800 m, 14 August 1997, A. Dantchenko leg. (7) karyotype preparation DK-23-97-4, 2n=ca46; Russia, Caucasus, Daghestan, Gimrinsky Range, Gunib, 1800 m, 14 August 1997, A. Dantchenko leg. (8) karyotype preparation DK-27-97-2, n=23; Russia, Caucasus, Daghestan, Gimrinsky Range, Gunib, 1800 m, 14 August 1997, A. Dantchenko leg. (9) karyotype preparation n=?24; Russia, Caucasus, Daghestan, Chonkatau, V. Tikhonov leg. All paratypes are deposited in the Zoological Institute of the Russian Academy of Science (St. Petersburg).

Additional samples

(no DNA, no karyotype). 10 males: Russia, Caucasus, Daghestan, Gimrinsky Range, Gunib, 1450-1950 m, 11-16 August 1997, A. Dantchenko leg.

Males. Forewing length 16.5-18.5 mm.

Upperside: Ground colour bright glossy violet blue with narrow black marginal line, marginal part of forewings and hindwings slightly dusted with black scales, discal strokes absent, veins darkened distally, costal area of the forewings white, basal part of fringe dark grey on forewings, light grey on hindwings, distal part white.

Underside: Forewing ground colour grey, submarginal row blurred, but clear visible; discoidal strokes black, bordered with white; postdiscal rows of black spots bor dered with white, 80% males have basal black spots; hindwing ground colour grey with ocherous tint, basal area with strong greenish suffusion; discal stroke less prominent than on forewings; postdiscal row of black spots bordered with white, submarginal and antemarginal marking not strong but clear visible; submarginal row bordered distally with reddish brackets, more pronounced to anal end of row; white streak sharp, equal in width; basal half of fringes pale grayish on fore- and hindwings, distal part white.

Females remains unknown.

Genitalia. The male genitalia have a structure typical for other species of the subgenus Agrodiaetus ( Coutsis 1986).

Habitat and biology.

Stony steppe and dry meadows from 1500 up to 2000 m a.s.l. Flight period: mid-July to end of August, in a single generation. The new species flights syntopically and synchronously with P. shamil but on average about one decade earlier. Host plant is preliminary determined as Astragalus buschiorum ( Fabaceae ). Hibernation as first instar larvae.

Diagnosis.

Phenotypically P. (A.) australorossicus sp. n. is practically indistinguishable from allopatric closely related P. ninae , P. aserbeidschanus and P. lukhtanovi but the ground colour of the underside of the hindwings is grey in the new species, with ocherous tint, not light or dark brown. The new species differs from sympatric (syntopic and synchronous) P. shamil (Fig. 9c, d ) by specific structure of costal area of the forewings in males (Fig. 10 ). The submarginal row of spots on the forewing underside is more blurred (Fig. 9b ), not sharp and clear visible as in P. shamil (Fig. 9d ). Additionally, basal black spots are usually present on the underside of the forewings in P. (A.) australorossicus (Fig. 9b ); however, this character is not constant.

Genetically P. australorossicus and P. shamil are not close. They belong to two different species groups within the subgenus Agrodiaetus : to P. carmon group ( P. australorossicus ) and to P. cyaneus group ( P. shamil ).

The new species differs drastically from the genetically most closely related P. ninae and P. aserbeidschanus by its karyotype (by at least 9 fixed chromosomal fusions/fissions).

The new species is similar (but not identical) to P. lukhtanovi (n=21-22) and P. pierceae (n=22) with respect to the chromosome number. However, it differs from these species by COI barcodes and represents a different lineage of evolution within the P. damonide complex.

Etymology.

The name Polommatus australorossicus is an adjective of the masculine gender. This species name originates from the Latin words “australis” (south) and “rossicus” (Russian).

Figures

Figure 9. Specimens of Polyommatus (Agrodiaetus) australorossicus sp. n. and P. (A.) shamil. Both samples collected in Gunib (Russia, Caucasus, Daghestan, Gimrinsky Range, 1600 - 1800 m), 14 August 1997, by A. Dantchenko. a, b upperside (a) and underside (b) of the holotype of Polyommatus (Agrodiaetus) australorossicus sp. n. DK- 27 - 97, n = 23; arrow indicates basal black spot c, d upperside (c) and underside (b) of the paratype of Polyommatus (Agrodiaetus) shamil, CCDB- 17947 _ B 11, DK- 97 - 18, n = 17, 2 n = 34. Bar = 10 mm.

Figure 10. Pubescence of the anterior part of the forewing upper surface. a, b, c, d the anterior part of the forewing upper surface possesses a strong white pubescence in the area bordered by the costal margin (CM) and the veins R and R 2 + 3, i. e. this area is densely covered with relatively long white hairs (a P. aserbeidschanus b P. ninae, c P. arasbarani neglectus d P. australorossicus) e, f the white pubescence of the anterior part of the forewing upper surface is strongly reduced and limited to the only costal margin, the white hairs are short (e P. ciscaucasicus f P. shamil) g the white pubescence of the anterior part of the forewing upper surface is reduced, not dense (P. damonides) h schematic picture showing the venation of the forewing in Polyommatus and the photographed area (shaded). Bar = 3 mm.