Symmerista luisdiegogomezi Chacon
publication ID |
https://dx.doi.org/10.3897/zookeys.421.6342 |
publication LSID |
lsid:zoobank.org:pub:748B0457-9F84-43E5-A165-C2CE1A36CE58 |
persistent identifier |
https://treatment.plazi.org/id/81A8E740-7368-45A7-9BBE-6113BBC43D3E |
taxon LSID |
lsid:zoobank.org:act:81A8E740-7368-45A7-9BBE-6113BBC43D3E |
treatment provided by |
|
scientific name |
Symmerista luisdiegogomezi Chacon |
status |
sp. n. |
Taxon classification Animalia Lepidoptera Notodontidae
Symmerista luisdiegogomezi Chacon View in CoL sp. n. Figs 1-9
Material examined.
16 specimens (14 males, 2 females)
Type material.
Holotype male: INB0003536238 (dissected, COI barcoded), Costa Rica, Prov. Cartago, P.N. Tapanti, Macizo de La Muerte, Est. La Esperanza 9.69129-83.87683, 2600 m, September 2002, R. Delgado (INBio).
Paratypes: 13 males, 2 females. 2 males: INB0003756237, INB0003756364 Costa Rica, Prov. Limon, Parque Internacional La Amistad, Valle del Silencio, Alrededor del Refugio y el Sendero Circular, 9.110281-82.961934, 2450 m, 22-27 September 2003, D. Rubi, R. Gonzalez, R. Delgado (INBio). 4 males: INB0003316532, INB0003316533, INB0003316534, INB0003316535 Costa Rica, Prov. Cartago, El Guarco, Macizo de la Muerte, Sector La Esperanza, 9.686771-83.87775, 2600 m, June 2001, R. Delgado (INBio). Male: INB0003352709 Costa Rica, Prov. Cartago, Reserva Forestal Rio Macho. El Guarco, Macizo de la Muerte, Sector La Esperanza, 9.686771-83.87775, 2600 m, August 2001, R. Delgado (INBio). 2 males: INB0003387641 (dissected), INB0003387642, Costa Rica, Prov. Cartago, Reserva Forestal Rio Macho, El Guarco, Macizo de la Muerte, 9.686771-83.87775, 2600 m, October 2001, R. Delgado (INBio). 2 males: INB0003536234 (COI barcoded), INB0003536235 (COI Barcoded), INB0003536237 (COI barcoded), Costa Rica, Prov. Cartago, Parque Nacional Tapanti, Macizo de La Muerte, Est. La Esperanza, 9.69129-83.876832, 2600 m, September 2002, R. Delgado (INBio). 2 males: INB0003545221 (dissected, COI barcoded), INB0003545222 (COI barcoded) Costa Rica, Prov. Cartago, Parque Nacional Tapanti, Macizo de La Muerte, Est. La Esperanza, 9.69129-83.876832, 2600 m, October 2002, R. Delgado (INBio). Female: INB0003339209 (dissected, COI barcoded) Costa Rica, Prov. Cartago, El Guarco, Macizo de la Muerte, Est. La Esperanza. 9.686771-83.87775, 2600 m. July 2001. R. Delgado (INBio). Female: INB0003756274 Costa Rica, Prov. Limon, Parque Internacional La Amistad, Valle del Silencio, Alrededor Refugio y Sendero Circular, 9.110281-82.961934, 2450 m, 22-27 September 2003, D. Rubi, R. Gonzalez, R. Delgado (INBio).
Etymology.
This species is named in honor of the late Professor Luis Diego Gómez Pignataro of San Jose, Costa Rica, for his outstanding contribution to our knowledge of Costa Rican biodiversity, his support of the Museo Nacional de Costa Rica, and for inspiring me to become a naturalist and taxonomist.
Diagnosis.
Dorsal FW ground color dark brown with costal margin black; an irregular, long thin cream-colored mark from the reniform spot to the apex; fringe dark brown with beige scales where veins touch termen; dorsal HW dark brown. Male genitalia: St8 posterior margin concave with a pair of short postero-lateral projections, projections robust and heavily sclerotized with blunt apices; valva membranous, finely pubescent, sacculus smooth, its margin uniform, costa straight with a distal protuberance near apex; valva with two triangular spine-like processes, one at base, the other at juxta near anellus; uncus slightly concave, somewhat helmet shaped, dorsal surface rough, pubescent, ventral surface smooth with sparse pubescence; socii long, wide, pubescent at bases, narrow and flattened at apices, shape as in the figure; length of the phallus 3.1 mm, proximal part of phallus tube wide at the base, narrow in the middle, distal part of phallus tube robust, sclerotized, with a tubular lateral projection and rounded apex; proximal part of the vesica with a ventral scobinate patch, distal part of the vesica bulbous. Female genitalia: posterior apophyses longer and more slender than anterior apophyses; CB rounded and membranous, lacking a signum; DB wide and sclerotized; posterior margin of postvaginal plate sclerotized and emarginate.
Description.
Male (Figs 1, 2, 5-8). Head - Antenna bipectinate, dark brown, six terminal flagellomeres without rami, antennal shaft dark brown dorsally and beige ventrally; scape bearing a long tuft of beige scales; haustellum reduced to two small lobes; eye smooth, round, black; frons mostly dark brown and black with brown-yellow scales; labial palpus porrect, dark brown ventrally, light brown dorsally; vertex brown yellow; patagium light brown. Thorax and abdomen - Tegula dark brown at base, a mix of cream and dark brown scales distally; mesoscutellum dark brown; thoracic pleuron from creamy white to dark brown; dorsal area of metathorax with black hair-like scales; legs mostly dark brown with cream-colored scales between segments; abdominal dorsum dirty beige, venter beige. Wings - Dorsal FW ground color dark brown, with reniform spot black; basal band light brown; M sinuous, light brown; postmedial band light brown; an irregular, thin cream-colored bar from reniform spot to apex; AD black; fringe dark brown with beige scales where veins touch termen; a light beige area between subterminal line and postmedial band of M3 extending to tornus; dorsal HW dark brown; fringe dark brown with beige scales where veins touch termen (Figs 1, 2) (WL 17.20-19.21 mm). Genitalia (Figs 5-8) - T8 wider than long, with two windows, anterior margin slightly concave, posterior margin sclerotized; St8 wide at base, narrowing posteriorly, posterior margin concave with tiny sclerotized teeth on edge, with a pair of short lateral projections, these sclerotized with blunt apices (Fig. 7); valva membranous, finely pubescent, costulae absent, sacculus smooth, its margin uniform, costa straight with a distal protuberance near apex; valva with two triangular spine-like processes, one at base, other at juxta near anellus; tegumen narrowed dorsally; uncus slightly concave, somewhat helmet shaped, dorsal surface rough, pubescent, ventral surface smooth with sparse pubescence; socii long, wide, pubescent at bases, narrow and flattened at apices, shape as in the figure; juxta ovoid; vinculum lightly sclerotized (Fig. 5); length of phallus 3.1 mm, proximal part of phallus tube wide at base, narrow in middle, distal part of phallus tube robust, sclerotized, with a tubular lateral projection and rounded apex; proximal part of vesica with a ventral scobinate patch, distal part of the vesica bulbous (Fig. 8).
Female (Figs 3, 4, 9) Similar to the male: Head - Antenna filiform, antennal shaft dark brown with cream scales, scape bearing a long tuft of cream scales; frons and vertex dark brown; haustellum vestigial; labial palpus dark brown. Thorax and abdomen - Mostly dark brown, tegula beige; dorsal area of metathorax with black hair-like scales; abdominal dorsum light brown, venter beige. Wings - Dorsal FW ground color dark brown; antemedial band beige, lined on both sides by sinuous dark brown lines; irregular white thin bar from apex to reniform spot; reniform spot black; postmedial band beige, subterminal line black; a light beige area between subterminal line and postmedial band of M3 extending to tornus; fringe dark brown with beige scales located where veins touch termen. Dorsal HW dirty beige; postmedial line light brown; discal spot black; fringe dark brown with beige scales located where veins touch termen (Figs 3, 4) (WL 20.22-21.51 mm). Genitalia (Fig. 9) - Papillae anales slightly ovoid, setose; posterior apophyses longer and more slender than anterior apophyses; DB wide and sclerotized; CB rounded and membranous, lacking a signum; posterior margin of postvaginal plate sclerotized and emarginate.
Distribution and habitat.
Symmerista luisdiegogomezi has been collected only between 2450 and 2600 m in the highland cloud forests dominated by Quercus trees in the foothills west of the Cordillera de Talamanca (Talamanca Mountain Range), southern Costa Rica (Fig. 49).
Remarks.
DNA barcode of male holotype INB0003536238.
MHMXP012-08 | INB0003536238 | Symmerista luisdiegogomezi | COI-5P
ACATTATATTTCATTTTTGGAATTTGAGCAGGTATAGTTGGAACTTCATTAAGCCTATTAATTCGAGCTGAATTAGGAAATCCAGGATCCCTTATTGGGGATGATCAAATTTATAATACAATTGTTACAGCCCATGCCTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGGGGATTTGGTAATTGATTAATTCCCCTTATATTAGGGGCCCCAGACATAGCATTCCCACGTATAAATAATATAAGTTTTTGACTTTTACCCCCCTCCTTAACCCTTTTAATTTCAAGAAGAATTGTAGAAAATGGGGCAGGAACTGGATGAACAGTGTACCCCCCACTATCATCCAATATTGCTCATAGTGGAAGTTCTGTAGATTTAGCTATTTTTTCCCTTCATTTAGCTGGAATTTCATCAATTTTAGGGGCCATTAATTTTATTACAACAATTATTAATATACGTCTCAATAATATATCCTTTGATCAAATACCTTTATTTGTTTGGGCTGTTGGGATTACAGCATTTTTACTTTTACTTTCTTTACCTGTTTTAGCTGGAGCTATTACAATACTACTAACTGATCGAAATTTAAACACATCTTTTTTTGACCCTGCAGGAGGGGGAGATCCAATTTTATATCAACATTTA
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
SubFamily |
Nystaleinae |
Genus |