Pseudoentrophospora kesseensis Tedersoo & Magurno, 2024

Tedersoo, Leho, Magurno, Franco, Alkahtani, Saad & Mikryukov, Vladimir, 2024, Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes), MycoKeys 107, pp. 249-271 : 249-271

Pseudoentrophospora kesseensis Tedersoo & Magurno sp. nov.

Diagnosis.

Differs from other species of Pseudoentrophospora and Entrophospora based on the ITS region (ITS 2 positions 127–146 gaaccgcaaattacgcatta, one mismatch allowed) and LSU (positions 486–515 gaacaggtcaacatcaattcttattgccat, one mismatch allowed) as indicated in Fig. 3 .

Type.

Soil eDNA sample TUE 101916 (holotype); eDNA sequence EUK 1631429 (lectotype); GSMc plot G 4940, coppiced Juniperus - Acer woodland (soil sample TUE 001916 ) in Kesse Island , Estonia, 58.63443 ° N, 23.43938 ° E .

Description.

Other eDNA sequences EUK 1636430 – EUK 1636432 from the type locality.

Etymology.

pseudo (Greek) = false; Entrophospora (Latin) refers to a related fungal genus; and kesseensis (Latin) indicates locality of the type species. The name depicts phylogenetic relatedness to Entrophosphora and the only locality where the type species has been recorded.

Notes.

Found from a single site, with ITS and LSU sequences differing up to 0.5 % and 1 %, respectively. The ITS 1 subregion harbours only 58 bases, being amongst the shortest across fungi (excl. microsporidians).

Figures

Figure 3. Diagnostic barcodes for Pseudoentrophospora kesseensis relative to closely-related taxa in ITS 2 and LSU.