Pompeius fuscus Grishin, 2023

Zhang, Jing, Cong, Qian & Grishin, Nick V., 2023, Supplementary Materials and Appendix, Insecta Mundi 2023 (26), pp. 1-115 : 42-44

Pompeius fuscus Grishin , new species

https://zoobank.org/ A3D335E7-A11D-4361-B8C1-A9BD1924462E

( Fig. 4 part, 97–98, 320–321)

Definition and diagnosis. Phylogenetic analysis of specimens from Brazil identified as Pompeius amblyspila (Mabille, 1898) (type locality in Bolivia) reveals that they are not monophyletic with and strongly differentiated genetically from it ( Fig. 4): e.g., their COI barcodes differ by 4.2% (28 bp) and therefore represent a new species. Inspection of (and sequencing of two, Fig. 4) of primary type specimens of taxa placed as junior subjective synonyms of P. amblyspila confirms their synonymy and distinctness of the new species from Brazil. This new species keys to P. amblyspila (M.15.4) in Evans (1955) but differs from it and other relatives by rounder wings, narrower stigma, pale spots in forewing cells CuA 1 -CuA 2 and M 3 -CuA 1 being rounder and placed farther distad from stigma, hindwing pale spots smaller and in a more even arc closer to the margin, and veins ventrally with pale overscaling towards outer margin. This species is not cryptic and is diagnosed reliably by phenotype. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly320.4.1:T75C, aly 1838.7.1:T387C, aly 1838.7.1:T2038C, aly 1651.4.1:A404G, aly525.109.4:G81A, and COI barcode: T19C, T139C, T340C, T376A, T472C, T541C.

Barcode sequence of the holotype. Sample NVG-19093D05, GenBank OR837667, 658 base pairs: AACTTTATATTTTATTTTCGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGAACAGAATTAGGTAATCCTGGTTCTTTAATT GGAGATGATCAAATTTTTAATACTATTGTTACAGCTCATGCCTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATT GATTAGTACCATTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGAATATTACCACCATCATTAACATTATTAAT TTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGATGAACAGTTTACCCCCCTTTATCTTCTAATATTGCTCACCAAGGATCATCTGTTGATTTA GCAATTTTTTCCTTACATTTAGCTGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATCAAAAATATATCAT TTGATCAAATACCATTATTTGTTTGATCTGTTGGAATTACAGCTTTATTATTACTCTTATCTTTACCTGTTTTAGCTGGAGCTATTACTATACTTCT TACAGATCGAAATTTAAATACTTCTTTTTTTGATCCAGCAGGAGGAGGAGATCCTATTTTATACCAACATTTATTT

Type material. Holotype: ♂ currently deposited in the National Museum of Natural History , Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 97–98, bears the following four rectangular labels, three white: [ BRAZIL: MG 1250m | Serra do Cipo | 19°16′S 43°35′W | 17 Apr 1991 | Robbins & Becker], [DNA sample ID: | NVG-19093D05 | c/o Nick V. Grishin], [USNMENT | {QR Code} | 01589476], and one red [HOLOTYPE ♂ | Pompeius | fuscus Grishin ] . Paratypes: 2♂♂ from Brazil in USNM: NVG-18115B11 the same data as the holotype, except 18-Apr-1991 and NVG-19093D03 Mato Grosso, Diamantino, Alto Rio Arinos, 350-400 m, GPS −14.2167, −56.2000, 7-Feb-1986, E. Furtado.

Type locality. Brazil: Minas Gerais, Serra do Cipo, elevation 1250 m, GPS −19.2667, −43.5833.

Etymology. In Latin, fuscus means dark, muffled, dingy, brown, dusky, or tawny. Moreover, the pattern of paler yellow-brown spots and overscaling along veins in this species reminds us of the pattern observed in Anthrenus fuscus Olivier, 1789 ( Coleoptera ). The name is a masculine adjective.

Distribution. Recorded from the states of Mato Grosso and Minas Gerais in Brazil.