Polyommatus (Agrodiaetus) iphigenides zarmitanus, Lukhtanov & Dantchenko, 2021

Lukhtanov, Vladimir A. & Dantchenko, Alexander V., 2021, Chromosomal and DNA barcode analysis of the Polyommatus (Agrodiaetus) damone (Eversmann, 1841) species complex (Lepidoptera, Lycaenidae), Comparative Cytogenetics 15 (1), pp. 1-22 : 1

Polyommatus (Agrodiaetus) iphigenides zarmitanus subsp. nov.

Holotype.

(Fig. 5a, b ), male, BOLD process ID BPAL1393-12, field # CCDB-03030_F03, GenBank accession number MW186966; Uzbekistan, Samarqand Region, Nuratau Mts, near Zarmitan village, 40.40°N, 66.69°E, 1300 m, 11-13 June 1994, V. Lukhtanov leg., deposited in the Zoological Institute of the Russian Academy of Science (St. Petersburg).

COI barcode sequence of the holotype.

ACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGGACATCCCTAAGAATTTTAATCCGTATAGAATTGAGAACT CCTGGATCCTTAATTGGAGACGATCAAATTTATAATACTATTGTTACAGCCCATGCATTTATTATAATTTTTTTTATAGTTA TACCTATTATAATTGGGGGATTTGGTAATTGATTAGTTCCTTTAATATTAGGAGCACCTGATATAGCCTTCCCCCGATTAAA TAATATAAGATTCTGATTATTACCGCCATCATTAATACTACTAATTTCCAGAAGAATTGTAGAAAATGGAGCAGGAACAGGA TGAACAGTTTACCCCCCACTTTCATCTAATATTGCACATAGAGGATCATCTGTAGATTTAGCAATTTTCTCTCTTCATTTAG CAGGAATTTCTTCAATTTTAGGAGCAATTAATTTTATTACAACTATTATTAACATACGGGTAAATAATTTATCATTTGATCA AATATCATTATTTATTTGAGCAGTAGGAATTACAGCATTATTATTACTTTTATCTTTACCTGTATTAGCTGGAGCAATTACC ATATTATTAACAGATCGAAACCTTAATACCTCATTCTTTGACCCAGCTGGTGGGGGAGATCCAATTTTATATCAACATTTA.

Paratypes.

39 males, 14 females: Uzbekistan, Samarqand Region, Nuratau Mts, near Zarmitan village, 40.40°N, 66.69°E, 1300 m, 11-13 June 1994, V. Lukhtanov leg. 2 males: Uzbekistan, Qashqadaryo Region (old spelling: Kashkadarya Region), Hissar Range (west), near Tamshush village, 38.98°N, 67.35°E, 1800 m, 18-20 June 1994, V. Lukhtanov leg. 20 males: Uzbekistan, Qashqadaryo Region (old spelling: Kashkadarya Region), Hissar Range (west), near Tamshush village, 38.98°N, 67.35°E, 1800 m, 5-7 July 1994, V. Lukhtanov leg. 11 males, 2 females: Uzbekistan, Surxondaryo Region (old spelling: Surkhandarya Region), Hissar Range (west), Sangardak, 38.55°N, 67.50°E, 1600 m, 2 July 1994, V. Lukhtanov leg. 60 males, 21 females: Uzbekistan, Samarqand Region, Zeravshansky Range, Aman-Kutan, 1800 m, 39.27°N, 66.90°E, 7 July 1994, V. Lukhtanov leg. 13 males: Tajikistan, Sughd Region, Zeravshansky Range, Padzhrud village, 39.37°N, 68.03°E, 1300 m, 17 males, 13 males, 10 June 1994. All above paratypes are deposited in the Zoological Institute of the Russian Academy of Science (St. Petersburg). 5 males: Uzbekistan, [Jizzakh region], Usmat vic., 1700 m, 30.06.1988, V. Tshikolovets leg., in State Darwin Museum, Moscow. 15 males: [Uzbekistan], Aman-Kutan near Samarqand, 20 June 1938, A. Tsvetaev leg., in State Darwin Museum, Moscow. 26 males, 1 female: [Tajikistan], Hisar-Alai, Zeravshansky Range, Farob, 2000 m, 4 July 1998, G.D. Samodurov leg., in State Darwin Museum, Moscow. 1 female: Tajikistan, West Hissar, Nofin lake, 2400, 17 July 1993, S. Churkin leg., in State Darwin Museum, Moscow. 32 males: [Uzbekistan], Aman-Kutan near Samarqand, 15-25 June 1938, A. Tsvetaev leg., in Zoological Museum Moscow University, Moscow (ZMMU). 7 males: [Uzbekistan], Aman-Kutan near Samarqand, 20-23 June 1938, G.Pashin leg., in ZMMU. 2 males: [Uzbekistan], Aman-Kutan near Samarqand, 27 July and 5 August 1937, A. G. Pashin leg., in ZMMU. 3 females: [Uzbekistan], Aman-Kutan near Samarqand, 15-26 June 1938, A. Tsvetaev leg., in ZMMU. 8 males: Tajikistan, West Hissar, Khazorchashma lake, 2800, 26 July 1993, S. Churkin leg.; 1 female: Tajikistan, West Hissar, Nofin lake, 2400, 17 July 1993, S. Churkin leg., in coll. Churkin (Reutov, Russia). 2 males, 1 female: Uzbekistan, West Hissar, Boysun Mts, Mochay, 1500 m, 26 June 1980, V. Tuzov leg., in coll. Tuzov (Moscow). 10 males, 1 female: [Uzbekistan], Aman-Kutan near Samarqand, 19-23 June 1938, A. Tsvetaev leg., in coll. Sochivko A. (Moscow). 10 males, 1 female: [Tajikistan], Hissar-Alai, Zeravshansky Range, Farob, 2000 m, 4 July 1998, L. Nikolaevsky leg., in coll. V. Kalinin, Moscow.

Description.

Males. Forewing length 15-17 mm.

Upperside: Ground color bright glossy milky blue with narrow black marginal line, marginal part of forewings and hindwings dusted with black scales, discal strokes may be present or absent, veins darkened, costal area of the forewings white, hindwings with antemarginal spots, fringe white.

Underside: Forewing ground color light grey, submarginal row blurred, but clear visible; discoidal strokes black, bordered with white; postdiscal rows of black spots bordered with white, basal black spots absent; hindwing ground color light grey, basal area with strong greenish blue suffusion between wing root and basal spots; basal spots small, bordered with white, discal stroke less prominent than on forewings; postdiscal row of black spots bordered with white, submarginal and antemarginal marking strong and clear visible; submarginal row bordered distally with reddish lunules, more pronounced to anal end of row; white streak not contrasting, often hardly noticeable or absent at all, fringes pale grayish.

Genitalia. The male genitalia have a structure typical for other species of the subgenus Polyommatus Agrodiaetus ( Coutsis 1986, Eckweiler and Bozano 2016).

Females. (Fig. 6a, b ) Forewing length 15-17 mm.

Upperside: Ground color brown with slightly darker veins, discal strokes present, submarginal and antemarginal marking almost absent on fore wings and strong and clear visible on hindwings, antemarginal black spots on hindwings bordered with orange lunules, fringe whitish.

Underside: ground color and general design as in males but darker, brownish grey, greenish blue basal suffusion near invisible, white streak on hindwings clear visible, enlarged distally, fringe light greyish.

Diagnosis.

The new subspecies is distinguished phenotypically from the most similar P. iphigenides iphigenides (Figs 5c-f , 6c, d ) by the underside of the hind wing, which has a paler and less contrasting coloration. The white streak is also dim and weakly stands out against the background of the wing, is often reduced or absent. The same can be said about the basal greenish-blue suffusion: it is dim and weakly stands out against the background of the wing; its size, on average, is much smaller than that in P. iphigenides iphigenides . As a rule, it is limited by black dots of the basal row, while in P. iphigenides iphigenides it usually extends further in the distal direction, sometimes to spots of the discal row. This suffusion itself has a more greenish tint than that in P. iphigenides iphigenides (in the latter, it is more blue). The new species always has black dots of the basal row (although they are small), while in another species they are reduced.

The main differences between the species are still in the molecular characters. Polyommatus iphigenides zarmitanus can be distinguished from P. iphigenides iphigenides by using molecular markers from the COI gene. These mitochondrial diagnostic characters are in the following positions in the COI barcode region: adenine (A) in position 22, cytosine (C) in position 132, guanine (G) in position 180, cytosine (C) in position 286, guanine (G) in position 468, guanine (G) in position 468, and guanine (G) in position 627.

The new subspecies differs from sympatric (syntopic and synchronous) P. phyllides by milky blue (not greenish blue) wing upperside and white pubescence of the costal area of the forewings in males and by light grey color of the wing underside ( P. phyllides has specific warm pinkish grey color of the wing underside). It also differs from P. phyllides by diagnostic nucleotide guanine (G) in position 627 of the COI barcode region.

Distribution area

(Fig. 7 ). Uzbekistan: West part of the Hissar Range, Zeravshan Mts, Nuratau Mts, Boysun (= Baisuntau) Mts. Tajikistan: west part of the Zeravshan valley and Zeravshansky Range, West Hisar Range.

Habitat and biology.

Stony steppe and dry meadows from 1200 up to 2800 m alt. Flight period from late May to first decade of August in a single generation. The new subspecies flies syntopically and synchronously with the second generation of P. (A.) phyllides , but on average about one decade earlier. Host plant is preliminary determined as Hedysarum sp. ( Fabaceae ).

Etymology.

The name Polyommatus zarmitanus is an adjective of the masculine gender. This name originates from Zarmitan, the village in Uzbekistan.

Figures

Figure 5. Males of Polyommatus (Agrodiaetus) iphigenides a, b upperside (a) and underside (b) of the holotype of P. (A.) iphigenides zarmitanus subsp. nov. c, d upperside (c) and underside (d) of P. (A.) iphigenides iphigenides, Tajikistan, Transalai Mts, Shibe village e, f upperside (e) and underside (f) of the Lectotype of P. (A.) iphigenides iphigenides, " Namangan ", in Museum fuer Naturkunde, Humboldt-Universitaet zu Berlin g, h upperside (g) and underside (h) of the Lectotype of P. (A.) iphigenides melanius, in Museum fuer Naturkunde, Humboldt-Universitaet zu Berlin. Scale Bars: 10 mm.

Figure 6. Females of Polyommatus (Agrodiaetus) iphigenides a, b upperside (a) and underside (b) of the paratype of P. (A.) iphigenides zarmitanus subsp. nov. c, d upperside (c) and underside (d) of P. (A.) iphigenides iphigenides, Tajikistan, Transalai Mts, Shibe village. Scale Bars: 10 mm.

Figure 7. Distribution area of P. (A.) iphigenides zarmitanus. 1 is the type-locality, Zarmitan in Nuratau Mts. 2 is Padzhrud village in Zeravshansky Range. 3 is Aman-Kutan near Samarqand. 4 is Kitabsky Reserve in Hissar Range. 5 is Tamshush in Hissar Range. 6 is Sangardak in Hissar Range. 7 are Khazorchashma and Nofin lakes in Hissar Range. 8 is Mochay in Boysun Mts.