Pancorius guiyang Yang, Gu & Yu, 2023

Yang, Weicheng, Zhou, Yufeng, Gu, Dongxue & Yu, Hao, 2023, Pancorius guiyang sp. nov., a new species of jumping spiders (Araneae, Salticidae) from Guizhou Province, China, Biodiversity Data Journal 11, pp. 108159-108159 : 108159

Pancorius guiyang Yang, Gu & Yu sp. nov.

Materials

Type status: Holotype. Occurrence: recordedBy: Qianle Lu; individualID: YHGY199; individualCount: 1; sex: male; lifeStage: adult; behavior: foraging; preparations: whole animal (ETOH); associatedSequences: GenBank: OR372102 ; occurrenceID: 643415AE-C790-5664-8241-9BFF85089072; Taxon: order: Araneae; family: Salticidae; genus: Pancorius; specificEpithet: guiyang; scientificNameAuthorship: Yang, Gu & Yu; Location: continent: Asia; country: China; countryCode: CHN; stateProvince: Guizhou; county: Guiyang City; locality: Xiangzhigou scenic spot ; decimalLatitude: 26.78; decimalLongitude: 106.92; Identification: identifiedBy: Cheng Wang; dateIdentified: 2022-08; Event: samplingProtocol: by hand; samplingEffort: 10 km by foot; year: 2022; month: 6; day: 1; Record Level: basisOfRecord: PreservedSpecimen Type status: Paratype. Occurrence: recordedBy: Qianle Lu; individualID: YHGY200; individualCount: 1; sex: female; lifeStage: adult; behavior: foraging; preparations: whole animal (ETOH); associatedSequences: GenBank: OR372101 ; occurrenceID: 9CD77831-8341-5B15-B9EC-FC39ED3F29D3; Taxon: order: Araneae; family: Salticidae; genus: Pancorius; specificEpithet: guiyang; scientificNameAuthorship: Yang, Gu & Yu; Location: continent: Asia; country: China; countryCode: CHN; stateProvince: Guizhou; county: Guiyang City; locality: Xiangzhigou scenic spot ; decimalLatitude: 26.78; decimalLongitude: 106.92; Identification: identifiedBy: Cheng Wang; dateIdentified: 2022-08; Event: samplingProtocol: by hand; samplingEffort: 10 km by foot; year: 2022; month: 6; day: 1; Record Level: basisOfRecord: PreservedSpecimen

Description

Description. Male (holotype) (Fig. 2 A-C, Fig. 3 A-D, Fig. 4 F, Fig. 5 A-C). Dimensions in mm. Total length 7.87; carapace 4.02 long, 2.88 wide; abdomen 3.85 long, 2.35 wide. Eye sizes and interdistances: anterior median eyes (AME) 0.90, anterior lateral eyes (ALE) 0.48, posterior median eyes (PME) 0.10, posterior lateral eyes (PLE) 0.45; anterior eye row width (AERW) 2.77, posterior eye row width (PERW) 2.60, length of eye field (EFL) 2.02. Clypeal height 0.21. Sternum 1.71 long, 0.98 wide. Leg length: I 9.37 (2.55, 3.83, 1.95, 1.04), II 7.652 (2.37, 3.09, 1.30, 0.89), III 8.37 (2.67, 2.92, 1.86, 0.92), IV 9.10 (2.89, 3.19, 2.16, 0.86).

Living holotype male as in Fig. 2 A-C, carapace was black, clothed with white hairs; abdomen covered with dense, white hairs, mottled with red patches; legs light yellow, all legs with conspicuous dark annuli in the distal parts of femur, patella and tibia.

Habitus in ethanol (Fig. 4 F, Fig. 5 A-C). Carapace black, broadened, marginally with dense, white hairs; cephalic region bearing a longitudinal, broad, distinct band of hairs, centrally with a pair of nearly triangular areas. Fovea indistinct, represented by a dark, longitudinal slit. Chelicerae deep dark, with two promarginal and one retromarginal teeth. Labium and endites basically coloured as chelicerae, endites depressed posteriorly, slightly convergent anteriorly, antero-inner margins white; labium nearly linguiform, anterior margin with sparse setae. Sternum light brown centrally, dark marginally, more or less shield-shaped. Abdomen elongate-oval in dorsal view, tapering posteriorly. Dorsum basically black, centrally with a narrow scutum extending ca. 1/2 of abdomen length, gradually narrowing posteriorly, with two pairs of inconspicuous muscular depressions on either side, followed by four ˄-shaped streaks, covered with dark thin hairs; venter pale yellow laterally, with a broad dark brown patch bearing a pair of dotted lines centrally.

Palp (Fig. 3 A-D). Tibia short, nearly as wide as long, ca. 2/5 length of cymbium (Cy); retrolateral tibial apophysis (RTA) short, about 1/3 of tibia length, thumb-like, tip sharp and point antero-dorsally. Tegulum (T) elongate, oval and bulging, about 1.3 × longer than wide; sperm duct (SD) indistinct in prolateral and ventral view, distinct in retrolateral view, forming a loop along tegular margin; tegulum with tapered posterior lobe extending downwards in ventral view, lobe (L) finger-like and located at approximately the 5-6 o’clock position. Embolar base (EB) represented by an enlarged tubercle, situated antero-prolateral of the tegulum (approximately 9-10 o’clock position); the free part of embolus (E) needle-shaped, strongly sclerotised, slightly curved medially and tapering at distal half to a pointed tip, terminating at ca. 12 o’clock position, apex directed towards about 1 o’clock position.

Female (Fig. 2 D-F, Fig. 4 A-E, G, Fig. 5 D-F). Dimensions in mm. Total length 9.72; carapace 4.27 long, 3.08 wide; abdomen 5.94 long, 4.18 wide. Eye sizes and interdistances: AME 0.81, ALE 0. 51, PME 0.10, PLE 0.47; AERW 2.78, PERW 2.71, EFL 2.01. Clypeal height 0.20. Sternum 1.70 long, 1.05 wide. Leg length: I 7.69 (2.33, 3.17, 1.29, 0.90), II 6.94 (2.21, 2.83, 0.84, 1.06), III 8.66 (2.68, 3.07, 1.72, 1.19), IV 8.75 (2.69, 3.18, 1.84, 1.04).

One living paratype female as in Fig. 2 D-F, carapace dark in front, yellowish-brown posteriorly and marginally, densely covered with orange setae around eye field; abdomen basically black, centrally with large, yellowish-white patterns, sparsely mottled with red hairs; legs light yellow, all legs with conspicuous reddish-brown annuli in the distal parts of femur, patella, tibia and metatarsus.

Colour in ethanol Fig. 4 G, Fig. 5 D-F). Carapace red-brown to yellowish-brown; eye field red-brown centrally, black marginally; thorax yellowish-brown, with a black, nearly W-shaped transverse band. Dorsum of abdomen with a longitudinal yellowish-white band consisting of two arrow-shaped patterns, ca. 2/3 length of abdomen. Other characters as in holotype male, but distinctly larger in size.

Epigyne (Fig. 4 A-E). Epigynal plate slightly longer than wide, margin distinctly delimited; spermathecae (SP) clearly visible through the tegument in ventral view. Copulatory openings (CO) longitudinal, slit-shaped, anteriorly widened. Paired epigynal pockets represented by two clefts in which is situated the posterior margin of epigynal plate, small and nearly triangular, separated from each other by ca. 1 × their width. Copulatory ducts (CD) short, proximally slender, extending and widening posteriorly, descending obliquely, finally connecting with posteriorly located spermathecae. Spermathecae (SP) large, almost round, obviously separated from each other about 1/2 their diameter; spermatheca divided into two oval chambers. Fertilisation duct (FD) membranous and lamellar, large, ca. 2/3 of spermathecal diameter, originating from the antero-inner surface of anterior chamber of spermatheca, anterolaterally extending.

DNA barcodes

5'GGTGCTTGAGCTGCTATAGTAGGAACTGCAATAAGAGTATTAATTCGTATAGAATTGGGGCAAACTGGGAGATTTTTAGGCAATGAACATTTATATAATGTAATTGTTACAGCACACGCATTTGTAATAATTTTTTTTATAGTAATACCTATTTTAATTGGAGGATTTGGTAATTGATTAGTCCCTTTAATGTTGGGAGCGCCTGATATGGCTTTTCCTCGAATAAATAATTTGAGATTTTGATTATTACCTCCTTCTTTGATTTTGTTATTTATTTCTTCTATGGCTGAAATGGGAGTGGGAACAGGATGAACTGTTTATCCACCTTTAGCATCTATTGTAGGACATAATGGTAGTTCTGTGGATTTTGCTATTTTTTCTTTACATTTAGCTGGTGCTTCTTCTATTATAGGAGCTATTAATTTTATTTCAACTGTAATTAATATACGATCGGTAGGTATAACTTTGGATAAAGTTTCTTTATTTGTATGATCAGTTATTATTACTACTGTATTATTATTATTATCATTACCTGTGTTGGCGGGTGCTATTACTATATTATTGACAGATCGTAATTTTAATACTTCTTTTTTTGATCCAGCAGGTGGAGGAGATCCTATTTTATTTCAACATTTATTTTGATTTTTTG3' (holotype, YHGY199; Genebank: OR372102)

5'GGTGCTTGAGCTGCTATAGTAGGACTGCAATAAGAGTATTAATTCGTATAGAATTGGGGCAAACTGGGAGATTTTTAGGCAATGAACATTTATATAATGTAATTGTTACAGCACACGCATTTGTAATAATTTTTTTTATAGTAATACCTATTTTAATTGGAGGATTTGGTAATTGATTAGTCCCTTTAATGTTGGGAGCGCCTGATATGGCTTTTCCTCGAATAAATAATTTGAGATTTTGATTATTACCTCCTTCTTTGATTTTGTTATTTATTTCTTCTATGGCTGAAATGGGAGTGGGAGCAGGATGAACTGTTTATCCACCTTTAGCATCTATTGTAGGACATAATGGTAGTTCTGTGGATTTTGCTATTTTTTCTTTACATTTAGCTGGTGCTTCTTCTATTATAGGAGCTATTAATTTTATTTCAACTGTAATTAATATACGATCGGTAGGTATAACTTTGGATAAAGTTTCTTTATTTGTATGATCAGTTATTATTACTACTGTATTATTATTATTATCATTACCTGTGTTGGCGGGTGCTATTACTATATTATTGACAGATCGTAATTTTAATACTTCTTTTTTTGATCCAGCAGGTGGAGGAGATCCTATTTTATTTCAACATTTATTTTGATTTTTTG3' (paratype, YHGY200; Genebank: OR372101)

Diagnosis

The male of this new species closely resembles that of P. crinitus Logunov & Jäger, 2015 from Vietnam and P. candidus Wang & Wang, 2020 from China. The three species share the similarly distinctly short RTA whose apex points dorsally (vs. RTA relatively longer and apex pointing anteriorly in all other congeners). However, P. guiyang sp. nov. can be differentiated from P. crinitus and P. candidus by the distinctly slender, needle-shaped embolus without subdistal projection (Fig. 3 A) (vs. embolus thicker and claw-shaped in P. crinitus as in Logunov and Jäger (2015): fig. 40, with a subdistal projection in P. candidus as in Wang and Wang (2020): figs. 5-7). The female of P. guiyang sp. nov. also resembles that of P. crinitus in having similar shape of the vulva, but can be separated by the paired epigynal pockets distinctly concaved, narrowed (vs. very shallow and wide) (cf. Fig. 4 A, C, E and Logunov and Jäger (2015): fig. 44) and by copulatory ducts descending slightly oblique (vs. running distinctly oblique, almost horizontal) (cf. Fig. 4 B, D and Logunov and Jäger (2015): fig. 43).

Etymology

The species name is derived from the name of the type locality; noun in apposition.

Distribution

Known from the Guiyang City, Guizhou Province, China (Fig. 1 ).

Biology

Pancorius guiyang sp. nov. is a typical leaf-dwelling spider, the types inhabit bamboo forest close to a small stream in the core zone of Xiangzhigou scenic spot and were collected by beating twigs and branches.

Figures

Figure 1. Distribution record of Pancorius guiyang sp. nov. (red circles). A Locality of Guiyang City in China; B map of Guiyang City, showing type locality of the new species, Wudang District, Xiangzhigou scenic spot.

Figure 2. Pancorius guiyang sp. nov., live specimens. A - C male holotype; D - F female paratype. Photographs by Qianle Lu (Shenzhen, Guangdong).

Figure 3. Male left palp of the holotype of Pancorius guiyang sp. nov. A Ventral view; B Dorsal view; C Prolateral view; D Retrolateral view. Abbreviations: Cy = cymbium; E = embolus; EB = embolar base; L = lobe; RTA = retrolateral tibial apophysis; SD = sperm duct; T = tegulum. Scale bar: 0.2 mm (equal for A-D).

Figure 4. Pancorius guiyang sp. nov., female paratype and male holotype, epigyne (A-E), frontal views of prosoma (F, G). A - B Macerated epigyne, ventral and dorsal; C - D Epigyne, macerated and embedded in Arabic gum, ventral and dorsal (dashed line in D showing schematic course of copulatory duct and connecting duct, dorsal); E Intact epigyne, ventral; F Male; G Female. Abbreviations: AS = anterior chamber of spermatheca; CD = copulatory duct; CO = copulatory opening; FD = fertilisation duct; P = epigynal pocket; PS = posterior chamber of spermatheca; SP = spermatheca. Scale bars: 0.2 mm (equal for A-E); 1 mm (F, G).

Figure 5. Habitus of Pancorius guiyang sp. nov., male holotype (A-C) and female paratype (D-F). A, D Dorsal view; B, E Ventral view; C, F Lateral view. Scale bars: 2 mm (equal for A-C, equal for D-F).