Pancorius guiyang Yang, Gu & Yu, 2023
publication ID |
https://dx.doi.org/10.3897/BDJ.11.e108159 |
publication LSID |
lsid:zoobank.org:pub:4A4D8B70-B97C-4938-B839-5C38B100FFEC |
persistent identifier |
https://treatment.plazi.org/id/09481E47-03AF-5C57-BD8D-B6D6DCDACCAC |
treatment provided by |
|
scientific name |
Pancorius guiyang Yang, Gu & Yu |
status |
sp. nov. |
Pancorius guiyang Yang, Gu & Yu sp. nov.
Materials
Type status: Holotype. Occurrence: recordedBy: Qianle Lu; individualID: YHGY199; individualCount: 1; sex: male; lifeStage: adult; behavior: foraging; preparations: whole animal (ETOH); associatedSequences: GenBank: OR372102 View Materials ; occurrenceID: 643415AE-C790-5664-8241-9BFF85089072; Taxon: order: Araneae; family: Salticidae; genus: Pancorius; specificEpithet: guiyang; scientificNameAuthorship: Yang, Gu & Yu; Location: continent: Asia; country: China; countryCode: CHN; stateProvince: Guizhou; county: Guiyang City; locality: Xiangzhigou scenic spot ; decimalLatitude: 26.78; decimalLongitude: 106.92; Identification: identifiedBy: Cheng Wang; dateIdentified: 2022-08; Event: samplingProtocol: by hand; samplingEffort: 10 km by foot; year: 2022; month: 6; day: 1; Record Level: basisOfRecord: PreservedSpecimen Type status: Paratype. Occurrence: recordedBy: Qianle Lu; individualID: YHGY200; individualCount: 1; sex: female; lifeStage: adult; behavior: foraging; preparations: whole animal (ETOH); associatedSequences: GenBank: OR372101 View Materials ; occurrenceID: 9CD77831-8341-5B15-B9EC-FC39ED3F29D3; Taxon: order: Araneae; family: Salticidae; genus: Pancorius; specificEpithet: guiyang; scientificNameAuthorship: Yang, Gu & Yu; Location: continent: Asia; country: China; countryCode: CHN; stateProvince: Guizhou; county: Guiyang City; locality: Xiangzhigou scenic spot ; decimalLatitude: 26.78; decimalLongitude: 106.92; Identification: identifiedBy: Cheng Wang; dateIdentified: 2022-08; Event: samplingProtocol: by hand; samplingEffort: 10 km by foot; year: 2022; month: 6; day: 1; Record Level: basisOfRecord: PreservedSpecimen GoogleMaps GoogleMaps GoogleMaps GoogleMaps
Description
Description. Male (holotype) (Fig. 2 View Figure 2 A-C, Fig. 3 View Figure 3 A-D, Fig. 4 View Figure 4 F, Fig. 5 View Figure 5 A-C). Dimensions in mm. Total length 7.87; carapace 4.02 long, 2.88 wide; abdomen 3.85 long, 2.35 wide. Eye sizes and interdistances: anterior median eyes (AME) 0.90, anterior lateral eyes (ALE) 0.48, posterior median eyes (PME) 0.10, posterior lateral eyes (PLE) 0.45; anterior eye row width (AERW) 2.77, posterior eye row width (PERW) 2.60, length of eye field (EFL) 2.02. Clypeal height 0.21. Sternum 1.71 long, 0.98 wide. Leg length: I 9.37 (2.55, 3.83, 1.95, 1.04), II 7.652 (2.37, 3.09, 1.30, 0.89), III 8.37 (2.67, 2.92, 1.86, 0.92), IV 9.10 (2.89, 3.19, 2.16, 0.86).
Living holotype male as in Fig. 2 View Figure 2 A-C, carapace was black, clothed with white hairs; abdomen covered with dense, white hairs, mottled with red patches; legs light yellow, all legs with conspicuous dark annuli in the distal parts of femur, patella and tibia.
Habitus in ethanol (Fig. 4 View Figure 4 F, Fig. 5 View Figure 5 A-C). Carapace black, broadened, marginally with dense, white hairs; cephalic region bearing a longitudinal, broad, distinct band of hairs, centrally with a pair of nearly triangular areas. Fovea indistinct, represented by a dark, longitudinal slit. Chelicerae deep dark, with two promarginal and one retromarginal teeth. Labium and endites basically coloured as chelicerae, endites depressed posteriorly, slightly convergent anteriorly, antero-inner margins white; labium nearly linguiform, anterior margin with sparse setae. Sternum light brown centrally, dark marginally, more or less shield-shaped. Abdomen elongate-oval in dorsal view, tapering posteriorly. Dorsum basically black, centrally with a narrow scutum extending ca. 1/2 of abdomen length, gradually narrowing posteriorly, with two pairs of inconspicuous muscular depressions on either side, followed by four ˄-shaped streaks, covered with dark thin hairs; venter pale yellow laterally, with a broad dark brown patch bearing a pair of dotted lines centrally.
Palp (Fig. 3 View Figure 3 A-D). Tibia short, nearly as wide as long, ca. 2/5 length of cymbium (Cy); retrolateral tibial apophysis (RTA) short, about 1/3 of tibia length, thumb-like, tip sharp and point antero-dorsally. Tegulum (T) elongate, oval and bulging, about 1.3 × longer than wide; sperm duct (SD) indistinct in prolateral and ventral view, distinct in retrolateral view, forming a loop along tegular margin; tegulum with tapered posterior lobe extending downwards in ventral view, lobe (L) finger-like and located at approximately the 5-6 o’clock position. Embolar base (EB) represented by an enlarged tubercle, situated antero-prolateral of the tegulum (approximately 9-10 o’clock position); the free part of embolus (E) needle-shaped, strongly sclerotised, slightly curved medially and tapering at distal half to a pointed tip, terminating at ca. 12 o’clock position, apex directed towards about 1 o’clock position.
Female (Fig. 2 View Figure 2 D-F, Fig. 4 View Figure 4 A-E, G, Fig. 5 View Figure 5 D-F). Dimensions in mm. Total length 9.72; carapace 4.27 long, 3.08 wide; abdomen 5.94 long, 4.18 wide. Eye sizes and interdistances: AME 0.81, ALE 0. 51, PME 0.10, PLE 0.47; AERW 2.78, PERW 2.71, EFL 2.01. Clypeal height 0.20. Sternum 1.70 long, 1.05 wide. Leg length: I 7.69 (2.33, 3.17, 1.29, 0.90), II 6.94 (2.21, 2.83, 0.84, 1.06), III 8.66 (2.68, 3.07, 1.72, 1.19), IV 8.75 (2.69, 3.18, 1.84, 1.04).
One living paratype female as in Fig. 2 View Figure 2 D-F, carapace dark in front, yellowish-brown posteriorly and marginally, densely covered with orange setae around eye field; abdomen basically black, centrally with large, yellowish-white patterns, sparsely mottled with red hairs; legs light yellow, all legs with conspicuous reddish-brown annuli in the distal parts of femur, patella, tibia and metatarsus.
Colour in ethanol Fig. 4 View Figure 4 G, Fig. 5 View Figure 5 D-F). Carapace red-brown to yellowish-brown; eye field red-brown centrally, black marginally; thorax yellowish-brown, with a black, nearly W-shaped transverse band. Dorsum of abdomen with a longitudinal yellowish-white band consisting of two arrow-shaped patterns, ca. 2/3 length of abdomen. Other characters as in holotype male, but distinctly larger in size.
Epigyne (Fig. 4 View Figure 4 A-E). Epigynal plate slightly longer than wide, margin distinctly delimited; spermathecae (SP) clearly visible through the tegument in ventral view. Copulatory openings (CO) longitudinal, slit-shaped, anteriorly widened. Paired epigynal pockets represented by two clefts in which is situated the posterior margin of epigynal plate, small and nearly triangular, separated from each other by ca. 1 × their width. Copulatory ducts (CD) short, proximally slender, extending and widening posteriorly, descending obliquely, finally connecting with posteriorly located spermathecae. Spermathecae (SP) large, almost round, obviously separated from each other about 1/2 their diameter; spermatheca divided into two oval chambers. Fertilisation duct (FD) membranous and lamellar, large, ca. 2/3 of spermathecal diameter, originating from the antero-inner surface of anterior chamber of spermatheca, anterolaterally extending.
DNA barcodes
5'GGTGCTTGAGCTGCTATAGTAGGAACTGCAATAAGAGTATTAATTCGTATAGAATTGGGGCAAACTGGGAGATTTTTAGGCAATGAACATTTATATAATGTAATTGTTACAGCACACGCATTTGTAATAATTTTTTTTATAGTAATACCTATTTTAATTGGAGGATTTGGTAATTGATTAGTCCCTTTAATGTTGGGAGCGCCTGATATGGCTTTTCCTCGAATAAATAATTTGAGATTTTGATTATTACCTCCTTCTTTGATTTTGTTATTTATTTCTTCTATGGCTGAAATGGGAGTGGGAACAGGATGAACTGTTTATCCACCTTTAGCATCTATTGTAGGACATAATGGTAGTTCTGTGGATTTTGCTATTTTTTCTTTACATTTAGCTGGTGCTTCTTCTATTATAGGAGCTATTAATTTTATTTCAACTGTAATTAATATACGATCGGTAGGTATAACTTTGGATAAAGTTTCTTTATTTGTATGATCAGTTATTATTACTACTGTATTATTATTATTATCATTACCTGTGTTGGCGGGTGCTATTACTATATTATTGACAGATCGTAATTTTAATACTTCTTTTTTTGATCCAGCAGGTGGAGGAGATCCTATTTTATTTCAACATTTATTTTGATTTTTTG3' (holotype, YHGY199; Genebank: OR372102)
5'GGTGCTTGAGCTGCTATAGTAGGACTGCAATAAGAGTATTAATTCGTATAGAATTGGGGCAAACTGGGAGATTTTTAGGCAATGAACATTTATATAATGTAATTGTTACAGCACACGCATTTGTAATAATTTTTTTTATAGTAATACCTATTTTAATTGGAGGATTTGGTAATTGATTAGTCCCTTTAATGTTGGGAGCGCCTGATATGGCTTTTCCTCGAATAAATAATTTGAGATTTTGATTATTACCTCCTTCTTTGATTTTGTTATTTATTTCTTCTATGGCTGAAATGGGAGTGGGAGCAGGATGAACTGTTTATCCACCTTTAGCATCTATTGTAGGACATAATGGTAGTTCTGTGGATTTTGCTATTTTTTCTTTACATTTAGCTGGTGCTTCTTCTATTATAGGAGCTATTAATTTTATTTCAACTGTAATTAATATACGATCGGTAGGTATAACTTTGGATAAAGTTTCTTTATTTGTATGATCAGTTATTATTACTACTGTATTATTATTATTATCATTACCTGTGTTGGCGGGTGCTATTACTATATTATTGACAGATCGTAATTTTAATACTTCTTTTTTTGATCCAGCAGGTGGAGGAGATCCTATTTTATTTCAACATTTATTTTGATTTTTTG3' (paratype, YHGY200; Genebank: OR372101)
Diagnosis
The male of this new species closely resembles that of P. crinitus Logunov & Jäger, 2015 from Vietnam and P. candidus Wang & Wang, 2020 from China. The three species share the similarly distinctly short RTA whose apex points dorsally (vs. RTA relatively longer and apex pointing anteriorly in all other congeners). However, P. guiyang sp. nov. can be differentiated from P. crinitus and P. candidus by the distinctly slender, needle-shaped embolus without subdistal projection (Fig. 3 View Figure 3 A) (vs. embolus thicker and claw-shaped in P. crinitus as in Logunov and Jäger (2015): fig. 40, with a subdistal projection in P. candidus as in Wang and Wang (2020): figs. 5-7). The female of P. guiyang sp. nov. also resembles that of P. crinitus in having similar shape of the vulva, but can be separated by the paired epigynal pockets distinctly concaved, narrowed (vs. very shallow and wide) (cf. Fig. 4 View Figure 4 A, C, E and Logunov and Jäger (2015): fig. 44) and by copulatory ducts descending slightly oblique (vs. running distinctly oblique, almost horizontal) (cf. Fig. 4 View Figure 4 B, D and Logunov and Jäger (2015): fig. 43).
Etymology
The species name is derived from the name of the type locality; noun in apposition.
Distribution
Known from the Guiyang City, Guizhou Province, China (Fig. 1 View Figure 1 ).
Biology
Pancorius guiyang sp. nov. is a typical leaf-dwelling spider, the types inhabit bamboo forest close to a small stream in the core zone of Xiangzhigou scenic spot and were collected by beating twigs and branches.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
Genus |