Nisoniades (Nisoniades) lutum Grishin, 2023

Zhang, Jing, Cong, Qian & Grishin, Nick V., 2023, Supplementary Materials and Appendix, Insecta Mundi 2023 (26), pp. 1-115 : 31-33

Nisoniades (Nisoniades) lutum Grishin , new species

https://zoobank.org/ 8CA203F6-1E1A-4B01-9D9E-FC3A9F5F0AA4

( Fig. 3 part, 71–72, 288–290)

Definition and diagnosis. Genomic trees reveal that specimens from western Mexico identified as Nisoniades bromias Godman and Salvin, 1894 (type locality in Mexico: Veracruz) form a distinct clade that is not even monophyletic with N. bromias in the mitochondrial genome tree (albeit with weaker statistical support of 86%) ( Fig. 3). Due to genetic differentiation, amplified by the genetic similarity within N. bromias and its lower evolutionary rate (comparatively shorter branches in Fig. 3), these western populations represent a new species. In the COI barcode, the new species differs from N. bromias and Nisoniades rubescens (Möschler, 1877) by 1.1% (7 bp) and 2.0% (13 bp), respectively. The new species keys to N. rubescens (E.19.5) in Evans (1953) and differs from its relatives by paler-brown wings with more contrasty and restricted dark-brown areas that form bands rather than ground color ( Fig. 71–72), broader ampulla of the right valva, and less sharply curved inward ampulla of the left valva ( Fig. 288–290). Due to the cryptic nature of this species, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly60.18.10:G18T, aly60.18.10:G78A, aly 2165.8.15:G39C, aly 2303.1.7:A31T, aly1222.34.1:G57A, and COI barcode: T82C, T292C, T328C, T619C, A628G.

Barcode sequence of the holotype. Sample NVG-4967, GenBank OR837654, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGATCCGGAATAGTAGGAACATCATTAAGCTTACTAATTCGATCTGAATTAGGTAACCCAGGATTTTTAATT GGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCCTTTATTATAATTTTCTTTATAGTAATACCCATTATAATTGGAGGATTCGGAAATT GATTAGTACCCCTTATATTAGGAGCTCCTGATATAGCTTTTCCCCGAATAAATAACATAAGATTTTGATTACTTCCTCCTTCTATTACTTTATTAAT CTCAAGTAGTATTGTAGAAAATGGAGCTGGAACAGGCTGAACTGTGTATCCACCTTTATCATCTAATATTGCTCACCAAGGCTCATCTGTTGATTTA GCAATTTTTTCATTACATTTAGCTGGAATTTCATCTATTTTAGGTGCTATTAATTTTATTACTACTATTATCAATATACGAATTAATAATTTATCAC TTGATCAAATACCTTTATTTGTTTGAGCCGTAGGAATTACAGCATTACTTTTATTATTATCTTTACCAGTTTTAGCTGGAGCTATCACAATATTATT AACTGATCGAAATTTAAATACATCTTTTTTTGATCCCGCAGGAGGGGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the National Museum of Natural History , Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 71–72, bears the following seven rectangular labels, six white: [Sierra de | GuerreroMex], [Jan. | ‘13], [RMuller | Collector], [3682], [DNA sample ID: | NVG-4967 | c/o Nick V. Grishin], [genitalia: | NVG151101-18 | Nick V. Grishin], and one red [HOLOTYPE ♂ | Nisoniades | lutum Grishin ] . Paratype: 1♂: NVG-4966 Mexico: Jalisco, Mismaloya area, Puerto Vallarta, 15-31-Oct-1973, P. M. Aubry leg., genitalia NVG 151101-17 [ USNM].

Type locality. Mexico: Guerrero.

Etymology. In Greek, βρωμιάς (bromias) means dirt or dirty, and lutum is dirt in Latin, used here as the name for the sister species of N. bromias . The name is a noun in apposition.

Distribution. Western Mexico, currently confirmed from Jalisco and Guerrero.